Incidental Mutation 'R2426:Gdi2'
ID250242
Institutional Source Beutler Lab
Gene Symbol Gdi2
Ensembl Gene ENSMUSG00000021218
Gene Nameguanosine diphosphate (GDP) dissociation inhibitor 2
SynonymsGDIB, Gdi3, GDI beta, GDI-B
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location3538063-3567871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3562034 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 330 (S330A)
Ref Sequence ENSEMBL: ENSMUSP00000152454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059515] [ENSMUST00000096069] [ENSMUST00000222365] [ENSMUST00000223396]
Predicted Effect probably benign
Transcript: ENSMUST00000059515
AA Change: S294A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062996
Gene: ENSMUSG00000021218
AA Change: S294A

DomainStartEndE-ValueType
Pfam:GDI 1 436 4.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096069
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000221581
AA Change: S31A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221875
Predicted Effect probably benign
Transcript: ENSMUST00000222365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222615
Predicted Effect probably benign
Transcript: ENSMUST00000222909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223046
Predicted Effect probably benign
Transcript: ENSMUST00000223396
AA Change: S330A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223501
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI2 is ubiquitously expressed. The GDI2 gene contains many repetitive elements indicating that it may be prone to inversion/deletion rearrangements. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Gdi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Gdi2 APN 13 3556467 missense probably benign 0.04
IGL01135:Gdi2 APN 13 3548855 splice site probably benign
IGL01402:Gdi2 APN 13 3564611 missense probably benign 0.24
IGL01404:Gdi2 APN 13 3564611 missense probably benign 0.24
IGL02100:Gdi2 APN 13 3556373 missense probably benign 0.03
IGL02305:Gdi2 APN 13 3556428 missense probably damaging 1.00
IGL02545:Gdi2 APN 13 3557009 missense probably damaging 1.00
IGL02561:Gdi2 APN 13 3548954 missense possibly damaging 0.94
IGL02939:Gdi2 APN 13 3564623 missense probably benign 0.21
E0354:Gdi2 UTSW 13 3561939 unclassified probably null
R1612:Gdi2 UTSW 13 3560051 missense probably benign 0.00
R1775:Gdi2 UTSW 13 3560018 missense possibly damaging 0.71
R1803:Gdi2 UTSW 13 3564547 nonsense probably null
R2254:Gdi2 UTSW 13 3554400 splice site probably null
R4081:Gdi2 UTSW 13 3548866 missense probably benign 0.10
R6365:Gdi2 UTSW 13 3565093 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGTTTTGTCACAGATTGCTCGC -3'
(R):5'- GACTCATCCATGCACTCCAG -3'

Sequencing Primer
(F):5'- GTCACAGATTGCTCGCTGTAAACAG -3'
(R):5'- GCAGACATTCCAGGCAGTG -3'
Posted On2014-11-12