Incidental Mutation 'R2426:Dsg1a'
ID250249
Institutional Source Beutler Lab
Gene Symbol Dsg1a
Ensembl Gene ENSMUSG00000069441
Gene Namedesmoglein 1 alpha
SynonymsDsg1
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20310811-20343350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20336804 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 629 (I629N)
Ref Sequence ENSEMBL: ENSMUSP00000076393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077146]
Predicted Effect probably damaging
Transcript: ENSMUST00000077146
AA Change: I629N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: I629N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 485 6.44e-1 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 590 598 N/A INTRINSIC
Pfam:Cadherin_C 659 781 1.6e-10 PFAM
low complexity region 786 799 N/A INTRINSIC
internal_repeat_1 823 888 9.56e-6 PROSPERO
internal_repeat_1 908 975 9.56e-6 PROSPERO
low complexity region 983 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Dsg1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Dsg1a APN 18 20340206 missense probably damaging 1.00
IGL01148:Dsg1a APN 18 20320925 missense probably damaging 0.97
IGL01534:Dsg1a APN 18 20340996 missense probably benign 0.06
IGL01566:Dsg1a APN 18 20336783 splice site probably benign
IGL01582:Dsg1a APN 18 20328848 missense probably null 1.00
IGL01913:Dsg1a APN 18 20322236 missense probably damaging 1.00
IGL01926:Dsg1a APN 18 20333584 missense possibly damaging 0.60
IGL02102:Dsg1a APN 18 20332032 missense probably benign 0.01
IGL02900:Dsg1a APN 18 20328656 splice site probably benign
IGL02937:Dsg1a APN 18 20331534 missense possibly damaging 0.93
IGL02962:Dsg1a APN 18 20340324 missense possibly damaging 0.92
IGL03003:Dsg1a APN 18 20336819 missense probably benign 0.43
R0126:Dsg1a UTSW 18 20340878 missense probably benign 0.00
R0200:Dsg1a UTSW 18 20340938 missense probably benign 0.00
R0284:Dsg1a UTSW 18 20331627 missense probably damaging 0.98
R0394:Dsg1a UTSW 18 20333750 missense probably damaging 1.00
R0543:Dsg1a UTSW 18 20340863 missense probably damaging 1.00
R0656:Dsg1a UTSW 18 20335892 splice site probably benign
R0733:Dsg1a UTSW 18 20338668 missense probably damaging 0.97
R0750:Dsg1a UTSW 18 20340153 missense probably benign 0.10
R1300:Dsg1a UTSW 18 20332149 missense probably benign 0.19
R1501:Dsg1a UTSW 18 20332019 missense probably damaging 1.00
R1523:Dsg1a UTSW 18 20322317 missense probably damaging 0.99
R1673:Dsg1a UTSW 18 20331504 missense probably damaging 1.00
R1980:Dsg1a UTSW 18 20338650 missense probably damaging 1.00
R2102:Dsg1a UTSW 18 20333773 missense probably damaging 1.00
R2132:Dsg1a UTSW 18 20340797 missense probably damaging 1.00
R2299:Dsg1a UTSW 18 20340150 missense probably damaging 1.00
R3031:Dsg1a UTSW 18 20340492 missense probably damaging 1.00
R4044:Dsg1a UTSW 18 20324030 missense probably damaging 1.00
R4075:Dsg1a UTSW 18 20340070 missense possibly damaging 0.53
R4644:Dsg1a UTSW 18 20340728 missense probably benign 0.04
R4661:Dsg1a UTSW 18 20340533 missense probably damaging 0.99
R4816:Dsg1a UTSW 18 20333722 missense probably benign 0.10
R5221:Dsg1a UTSW 18 20324014 missense possibly damaging 0.64
R5257:Dsg1a UTSW 18 20320931 missense probably damaging 1.00
R5360:Dsg1a UTSW 18 20340954 missense probably damaging 0.96
R5547:Dsg1a UTSW 18 20336040 critical splice donor site probably null
R5702:Dsg1a UTSW 18 20336865 critical splice donor site probably null
R5987:Dsg1a UTSW 18 20331542 missense probably damaging 1.00
R6108:Dsg1a UTSW 18 20340247 missense probably benign 0.19
R6170:Dsg1a UTSW 18 20335986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAACAGAGGTCACAAGGCAG -3'
(R):5'- GTCAGATCAGTTACAGTGGGC -3'

Sequencing Primer
(F):5'- GCAGGGCTTAAAAATGAGATTCAAC -3'
(R):5'- CGCTTCATTTACACATATGTTATGGG -3'
Posted On2014-11-12