Incidental Mutation 'R2426:Amot'
ID250253
Institutional Source Beutler Lab
Gene Symbol Amot
Ensembl Gene ENSMUSG00000041688
Gene Nameangiomotin
SynonymsD0Kist1, E230009N18Rik, Sii6
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R2426 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location145446425-145505181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145476291 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 460 (K460E)
Ref Sequence ENSEMBL: ENSMUSP00000108455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112835] [ENSMUST00000112836] [ENSMUST00000143610]
Predicted Effect probably damaging
Transcript: ENSMUST00000112835
AA Change: K71E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108454
Gene: ENSMUSG00000041688
AA Change: K71E

DomainStartEndE-ValueType
coiled coil region 20 61 N/A INTRINSIC
internal_repeat_1 75 95 9.29e-5 PROSPERO
low complexity region 140 149 N/A INTRINSIC
low complexity region 175 186 N/A INTRINSIC
Pfam:Angiomotin_C 189 398 1.4e-100 PFAM
low complexity region 426 442 N/A INTRINSIC
SCOP:d1gkub1 513 546 9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112836
AA Change: K460E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108455
Gene: ENSMUSG00000041688
AA Change: K460E

DomainStartEndE-ValueType
internal_repeat_1 152 207 2.13e-5 PROSPERO
low complexity region 321 336 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
Blast:PAC 452 493 6e-12 BLAST
low complexity region 529 538 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Pfam:Angiomotin_C 578 785 6.1e-97 PFAM
low complexity region 815 831 N/A INTRINSIC
low complexity region 862 1063 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125271
AA Change: K262E
SMART Domains Protein: ENSMUSP00000116189
Gene: ENSMUSG00000041688
AA Change: K262E

DomainStartEndE-ValueType
low complexity region 124 139 N/A INTRINSIC
low complexity region 150 168 N/A INTRINSIC
coiled coil region 211 252 N/A INTRINSIC
Blast:PAC 255 296 6e-12 BLAST
low complexity region 332 341 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Pfam:Angiomotin_C 381 588 2e-97 PFAM
low complexity region 618 634 N/A INTRINSIC
low complexity region 665 866 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000138187
AA Change: K278E
SMART Domains Protein: ENSMUSP00000117777
Gene: ENSMUSG00000041688
AA Change: K278E

DomainStartEndE-ValueType
low complexity region 140 155 N/A INTRINSIC
low complexity region 166 184 N/A INTRINSIC
coiled coil region 227 268 N/A INTRINSIC
Blast:PAC 271 312 5e-12 BLAST
low complexity region 348 357 N/A INTRINSIC
low complexity region 383 394 N/A INTRINSIC
Pfam:Angiomotin_C 397 604 1.1e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143610
AA Change: K460E

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120226
Gene: ENSMUSG00000041688
AA Change: K460E

DomainStartEndE-ValueType
low complexity region 321 336 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
Blast:PAC 452 493 2e-12 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null mutation exhibit impaired migration into proximal extraembryonic regions resulting in furrows of visceral endoderm at the junction of embryonic and extraembryonic regions, vascular insufficiency in the intersomitic region, dilated vessels in the brain and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Amot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Amot APN X 145487028 missense probably damaging 1.00
R1793:Amot UTSW X 145450589 unclassified probably benign
R4536:Amot UTSW X 145480142 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTGGCATAGTCCCAAATTTTC -3'
(R):5'- CATTTGAGTCATTGACTGAGCTTAC -3'

Sequencing Primer
(F):5'- ATCAGATGTCGTGGCACATGC -3'
(R):5'- TACAGTCTATCTGAAAGGAGATGC -3'
Posted On2014-11-12