Incidental Mutation 'R2427:Atp2a1'
List |< first << previous [record 74 of 958] next >> last >|
ID250277
Institutional Source Beutler Lab
Gene Symbol Atp2a1
Ensembl Gene ENSMUSG00000030730
Gene NameATPase, Ca++ transporting, cardiac muscle, fast twitch 1
SynonymsSERCA1
MMRRC Submission 040389-MU
Accession Numbers

Genbank: NM_007504.2; Ensembl: ENSMUST00000032974

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2427 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126445858-126463108 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 126446583 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Leucine at position 995 (*995L)
Ref Sequence ENSEMBL: ENSMUSP00000032974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000106405] [ENSMUST00000106407]
Predicted Effect probably null
Transcript: ENSMUST00000032974
AA Change: *995L
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730
AA Change: *995L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106405
SMART Domains Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 2 107 1.4e-41 PFAM
low complexity region 139 158 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
Pfam:Rabaptin 196 311 5.9e-10 PFAM
Pfam:Rab5-bind 289 456 4.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106407
SMART Domains Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 13 171 1.4e-39 PFAM
low complexity region 182 201 N/A INTRINSIC
low complexity region 218 237 N/A INTRINSIC
Pfam:Rab5-bind 274 487 4.1e-21 PFAM
Pfam:Rab5-bind 469 531 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133300
Predicted Effect probably benign
Transcript: ENSMUST00000146973
SMART Domains Protein: ENSMUSP00000119018
Gene: ENSMUSG00000030730

DomainStartEndE-ValueType
Pfam:Cation_ATPase_C 6 132 6.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151304
Meta Mutation Damage Score 0.444 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (37/37)
MGI Phenotype Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant neonates display respiratory distress, progressive cyanosis, and die within 30 minutes-2 hours after birth. Lung tissues and the diaphragm muscle show aberrant morphology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,109,761 F277L probably benign Het
Ankmy1 A G 1: 92,870,807 probably null Het
Axin2 T A 11: 108,923,974 N229K possibly damaging Het
Capn13 A T 17: 73,326,317 probably benign Het
Ccdc180 A G 4: 45,929,545 I1202V probably benign Het
Cep295 A G 9: 15,334,238 L974P probably damaging Het
Cers3 T C 7: 66,795,793 Y321H probably benign Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Ciao1 T C 2: 127,246,691 H104R probably damaging Het
Cldn4 A T 5: 134,946,477 V90E probably damaging Het
Crbn T C 6: 106,783,472 E253G probably damaging Het
Ctns A G 11: 73,196,686 W5R probably damaging Het
Eme1 G A 11: 94,650,975 probably benign Het
Fam19a4 C T 6: 97,014,367 probably benign Het
Fat2 T A 11: 55,310,812 T479S probably benign Het
Fbxw25 T C 9: 109,652,860 N253D probably benign Het
Fer A G 17: 63,957,303 I39V probably benign Het
Fmnl2 A G 2: 53,116,979 M768V probably damaging Het
Frg1 T C 8: 41,414,866 K24E probably damaging Het
I830077J02Rik G T 3: 105,928,004 A19D probably damaging Het
Ighv1-20 C T 12: 114,724,072 silent Het
Igsf9 A G 1: 172,490,739 S149G probably damaging Het
Klra10 T A 6: 130,279,335 I119F probably benign Het
Lrrc4b T A 7: 44,462,552 I616N probably damaging Het
Lrrc71 T C 3: 87,746,002 T64A probably benign Het
Ly9 A T 1: 171,607,232 I31N probably damaging Het
Mef2a A G 7: 67,266,060 S165P probably damaging Het
Nol4 T G 18: 22,850,698 probably benign Het
Plxnd1 C T 6: 115,967,748 probably null Het
Rab27b T C 18: 69,996,134 T30A probably damaging Het
Rasa4 A G 5: 136,102,027 D384G probably benign Het
Slx4 G A 16: 3,988,987 L531F probably damaging Het
Tgm1 C T 14: 55,712,100 probably null Het
Tpm2 T C 4: 43,523,306 N17D probably damaging Het
Tyrp1 A G 4: 80,850,871 T134A probably benign Het
Zfand6 T A 7: 84,634,290 K35* probably null Het
Zfp648 G A 1: 154,205,073 C326Y probably damaging Het
Other mutations in Atp2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Atp2a1 APN 7 126447216 nonsense probably null
IGL00474:Atp2a1 APN 7 126450294 nonsense probably null
IGL00500:Atp2a1 APN 7 126447216 nonsense probably null
IGL01112:Atp2a1 APN 7 126450307 missense probably benign 0.13
IGL01380:Atp2a1 APN 7 126448770 missense possibly damaging 0.84
IGL01503:Atp2a1 APN 7 126448578 missense probably damaging 1.00
IGL01630:Atp2a1 APN 7 126450265 missense probably benign 0.00
IGL01679:Atp2a1 APN 7 126456809 missense probably benign 0.00
IGL01729:Atp2a1 APN 7 126457934 missense probably damaging 0.99
IGL02290:Atp2a1 APN 7 126452649 splice site probably benign
IGL02929:Atp2a1 APN 7 126456944 missense probably damaging 1.00
IGL02951:Atp2a1 APN 7 126450227 missense possibly damaging 0.58
IGL03249:Atp2a1 APN 7 126462805 missense probably benign 0.12
1mM(1):Atp2a1 UTSW 7 126446909 missense probably damaging 1.00
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0121:Atp2a1 UTSW 7 126457944 missense probably damaging 1.00
R0398:Atp2a1 UTSW 7 126450418 unclassified probably benign
R0578:Atp2a1 UTSW 7 126450143 missense probably benign
R0626:Atp2a1 UTSW 7 126446990 critical splice acceptor site probably null
R0739:Atp2a1 UTSW 7 126448256 missense possibly damaging 0.87
R1558:Atp2a1 UTSW 7 126452672 missense possibly damaging 0.88
R1700:Atp2a1 UTSW 7 126462909 missense probably damaging 1.00
R1748:Atp2a1 UTSW 7 126459608 missense possibly damaging 0.67
R1799:Atp2a1 UTSW 7 126450142 missense probably benign 0.27
R1808:Atp2a1 UTSW 7 126453401 missense probably damaging 0.97
R2058:Atp2a1 UTSW 7 126447672 missense possibly damaging 0.60
R2143:Atp2a1 UTSW 7 126448725 nonsense probably null
R3113:Atp2a1 UTSW 7 126448369 missense probably damaging 1.00
R4501:Atp2a1 UTSW 7 126453383 missense probably benign 0.00
R4604:Atp2a1 UTSW 7 126448623 missense probably damaging 0.96
R4934:Atp2a1 UTSW 7 126453428 missense probably benign
R4939:Atp2a1 UTSW 7 126450116 missense probably benign
R5646:Atp2a1 UTSW 7 126453105 missense probably benign
R6093:Atp2a1 UTSW 7 126446921 missense probably damaging 1.00
R6556:Atp2a1 UTSW 7 126450262 missense probably benign 0.37
R6908:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R6911:Atp2a1 UTSW 7 126456836 missense probably damaging 1.00
X0022:Atp2a1 UTSW 7 126448250 missense possibly damaging 0.49
X0060:Atp2a1 UTSW 7 126462882 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCACCTGTGATGTGCCAGAC -3'
(R):5'- CCCTCTTCCTTTGTAGGTAGGTAGG -3'

Sequencing Primer
(F):5'- TGTGATGTGCCAGACCCCAAC -3'
(R):5'- AGGTAGGTAAGTTCTTTTTAGCCC -3'
Posted On2014-11-12