Mutagenetix > Incidental Mutation

Incidental Mutation 'R2428:Astn1'

250296

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

040390-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R2428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158189843-158519351 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 158439916 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 828 (A828V)

Ref Sequence

ENSEMBL: ENSMUSP00000039711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000194369] [ENSMUST00000195311]

AlphaFold

Q61137

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046110
AA Change: A828V

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: A828V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170718

SMART Domains

Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
Blast:MACPF	811	835	3e-7	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193042
AA Change: A836V

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: A836V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194041

Predicted Effect

probably benign
Transcript: ENSMUST00000194369

SMART Domains

Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
Blast:MACPF	803	828	2e-7	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195311
AA Change: A828V

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: A828V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Meta Mutation Damage Score

0.1424

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	G	A	3: 36,145,072 (GRCm39)	A624T	probably benign	Het
Bag6	A	C	17: 35,366,151 (GRCm39)	D1117A	probably damaging	Het
Col12a1	A	T	9: 79,509,533 (GRCm39)	C3042S	probably benign	Het
Ctc1	G	A	11: 68,918,527 (GRCm39)	V265I	possibly damaging	Het
Cubn	T	C	2: 13,480,961 (GRCm39)	Y298C	probably damaging	Het
Dmtn	G	A	14: 70,850,843 (GRCm39)	R183W	probably damaging	Het
F2rl2	T	A	13: 95,833,585 (GRCm39)	I5N	possibly damaging	Het
Gpr137c	A	G	14: 45,516,420 (GRCm39)	Y336C	probably damaging	Het
Gstm6	T	A	3: 107,850,922 (GRCm39)	I10F	possibly damaging	Het
Hivep3	T	A	4: 119,955,705 (GRCm39)	C1340*	probably null	Het
Igf1	A	G	10: 87,700,683 (GRCm39)	T36A	probably damaging	Het
Lrch1	T	A	14: 75,044,985 (GRCm39)		probably benign	Het
Mrpl40	A	T	16: 18,691,125 (GRCm39)	I195N	probably damaging	Het
Myg1	G	C	15: 102,246,171 (GRCm39)	G349R	probably damaging	Het
Ndufc1	A	C	3: 51,315,564 (GRCm39)		probably null	Het
Nfasc	T	C	1: 132,523,392 (GRCm39)	N973S	possibly damaging	Het
Or4f62	G	A	2: 111,986,787 (GRCm39)	V164I	probably benign	Het
Or51a43	G	A	7: 103,717,675 (GRCm39)	R188*	probably null	Het
Or6c212	T	C	10: 129,558,652 (GRCm39)	I254V	probably benign	Het
Or9g19	A	T	2: 85,600,322 (GRCm39)	Y59F	probably damaging	Het
Pkdrej	C	A	15: 85,701,773 (GRCm39)	E1388*	probably null	Het
Prrc2b	T	A	2: 32,106,067 (GRCm39)	D1482E	probably benign	Het
Relch	C	T	1: 105,673,851 (GRCm39)	S1080L	possibly damaging	Het
Sppl2a	A	T	2: 126,754,615 (GRCm39)	S403R	possibly damaging	Het
Tespa1	A	G	10: 130,197,944 (GRCm39)	D322G	probably damaging	Het
Tmcc2	C	T	1: 132,288,569 (GRCm39)	V373M	probably damaging	Het
Ttn	T	C	2: 76,644,517 (GRCm39)	N13079S	possibly damaging	Het
Wdr53	A	G	16: 32,071,008 (GRCm39)	I118V	probably benign	Het
Zdbf2	T	C	1: 63,344,774 (GRCm39)	M1051T	probably benign	Het
Zfp784	G	C	7: 5,041,357 (GRCm39)		probably benign	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158,427,889 (GRCm39)	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158,331,883 (GRCm39)	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158,407,897 (GRCm39)	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158,496,201 (GRCm39)	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158,338,724 (GRCm39)	intron	probably benign
IGL02168:Astn1	APN	1	158,436,911 (GRCm39)	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158,491,700 (GRCm39)	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158,338,520 (GRCm39)	splice site	probably benign
IGL02307:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158,329,978 (GRCm39)	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158,332,965 (GRCm39)	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158,516,120 (GRCm39)	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158,439,965 (GRCm39)	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158,496,193 (GRCm39)	splice site	probably benign
IGL03354:Astn1	APN	1	158,516,174 (GRCm39)	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158,424,781 (GRCm39)	missense	probably benign	0.23
PIT4366001:Astn1	UTSW	1	158,424,779 (GRCm39)	missense	probably benign	0.20
R0024:Astn1	UTSW	1	158,511,785 (GRCm39)	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158,407,294 (GRCm39)	splice site	probably benign
R0099:Astn1	UTSW	1	158,329,721 (GRCm39)	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158,516,118 (GRCm39)	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158,337,461 (GRCm39)	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158,427,959 (GRCm39)	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158,299,959 (GRCm39)	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158,337,460 (GRCm39)	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158,338,679 (GRCm39)	nonsense	probably null
R1027:Astn1	UTSW	1	158,407,849 (GRCm39)	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158,427,935 (GRCm39)	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158,329,923 (GRCm39)	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158,407,146 (GRCm39)	splice site	probably benign
R1701:Astn1	UTSW	1	158,331,877 (GRCm39)	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158,331,821 (GRCm39)	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158,429,515 (GRCm39)	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158,332,886 (GRCm39)	splice site	probably null
R1919:Astn1	UTSW	1	158,337,541 (GRCm39)	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158,348,091 (GRCm39)	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158,436,875 (GRCm39)	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158,484,690 (GRCm39)	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158,428,072 (GRCm39)	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158,299,978 (GRCm39)	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158,495,179 (GRCm39)	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158,329,720 (GRCm39)	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158,484,876 (GRCm39)	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158,407,236 (GRCm39)	missense	probably damaging	0.99
R2980:Astn1	UTSW	1	158,400,521 (GRCm39)	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158,495,102 (GRCm39)	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158,329,630 (GRCm39)	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158,407,227 (GRCm39)	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158,329,602 (GRCm39)	splice site	probably null
R4625:Astn1	UTSW	1	158,407,864 (GRCm39)	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158,329,821 (GRCm39)	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158,440,102 (GRCm39)	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158,407,933 (GRCm39)	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158,427,950 (GRCm39)	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158,429,507 (GRCm39)	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158,337,563 (GRCm39)	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158,491,691 (GRCm39)	nonsense	probably null
R6481:Astn1	UTSW	1	158,440,032 (GRCm39)	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158,338,718 (GRCm39)	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158,440,042 (GRCm39)	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158,491,644 (GRCm39)	nonsense	probably null
R7062:Astn1	UTSW	1	158,516,081 (GRCm39)	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158,400,557 (GRCm39)	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158,491,846 (GRCm39)	splice site	probably null
R7402:Astn1	UTSW	1	158,380,425 (GRCm39)	intron	probably benign
R7412:Astn1	UTSW	1	158,329,919 (GRCm39)	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158,438,352 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,495,208 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,332,956 (GRCm39)	missense	possibly damaging	0.84
R7635:Astn1	UTSW	1	158,495,105 (GRCm39)	nonsense	probably null
R7890:Astn1	UTSW	1	158,407,903 (GRCm39)	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158,429,508 (GRCm39)	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158,424,886 (GRCm39)	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158,516,208 (GRCm39)	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158,331,920 (GRCm39)	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158,436,890 (GRCm39)	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158,436,850 (GRCm39)	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158,329,803 (GRCm39)	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158,484,670 (GRCm39)	missense	probably benign	0.09
R8983:Astn1	UTSW	1	158,491,700 (GRCm39)	critical splice donor site	probably null
R9013:Astn1	UTSW	1	158,348,070 (GRCm39)	missense	probably damaging	1.00
R9110:Astn1	UTSW	1	158,496,327 (GRCm39)	missense	probably benign	0.01
R9156:Astn1	UTSW	1	158,338,555 (GRCm39)	missense	probably damaging	0.99
R9355:Astn1	UTSW	1	158,511,721 (GRCm39)	missense	probably damaging	1.00
R9683:Astn1	UTSW	1	158,491,619 (GRCm39)	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158,511,666 (GRCm39)	nonsense	probably null
Z1088:Astn1	UTSW	1	158,424,776 (GRCm39)	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158,300,067 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGGAGTCAGGATTTACCCTCC -3'
(R):5'- ATATTCCAGCCAGAGTCTCCG -3'

Sequencing Primer
(F):5'- CTTGAAAAGACACCTATTTGGGAAG -3'
(R):5'- AGAGTCTCCGCTGGACTTG -3'

Posted On

2014-11-12