Mutagenetix > Incidental Mutation

Incidental Mutation 'R2428:Dmtn'

250319

Institutional Source

Beutler Lab

Gene Symbol

Dmtn

Ensembl Gene

ENSMUSG00000022099

Gene Name

dematin actin binding protein

Synonyms

dematin, Epb4.9

MMRRC Submission

040390-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R2428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70839624-70873488 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70850843 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 183 (R183W)

Ref Sequence

ENSEMBL: ENSMUSP00000154373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022694] [ENSMUST00000022695] [ENSMUST00000110984] [ENSMUST00000226543] [ENSMUST00000227331] [ENSMUST00000228001] [ENSMUST00000228009] [ENSMUST00000228824] [ENSMUST00000228295]

AlphaFold

Q9WV69

Predicted Effect

probably damaging
Transcript: ENSMUST00000022694
AA Change: R208W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022694
Gene: ENSMUSG00000022099
AA Change: R208W

Domain	Start	End	E-Value	Type
Pfam:AbLIM_anchor	8	93	8e-30	PFAM
Pfam:AbLIM_anchor	79	347	1.9e-58	PFAM
VHP	348	383	1.88e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000022695
AA Change: R183W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099
AA Change: R183W

Domain	Start	End	E-Value	Type
low complexity region	60	72	N/A	INTRINSIC
low complexity region	88	99	N/A	INTRINSIC
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	188	220	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
VHP	345	380	1.88e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110984
AA Change: R208W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106612
Gene: ENSMUSG00000022099
AA Change: R208W

Domain	Start	End	E-Value	Type
low complexity region	11	29	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
low complexity region	113	124	N/A	INTRINSIC
low complexity region	174	185	N/A	INTRINSIC
coiled coil region	213	245	N/A	INTRINSIC
low complexity region	277	292	N/A	INTRINSIC
VHP	348	383	1.88e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226543

Predicted Effect

probably benign
Transcript: ENSMUST00000227331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227453

Predicted Effect

probably damaging
Transcript: ENSMUST00000228001
AA Change: R183W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228009
AA Change: R208W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228824
AA Change: R183W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228295
AA Change: R183W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.1315

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a targeted mutation display mild anemia and spherocytosis. Mutant erythrocytes are osmotically fragile and show reduced deformability and filterability as well as increased membrane fragmentation and selective loss of spectrin and actin from RBC membrane skeletons and vesicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	G	A	3: 36,145,072 (GRCm39)	A624T	probably benign	Het
Astn1	C	T	1: 158,439,916 (GRCm39)	A828V	possibly damaging	Het
Bag6	A	C	17: 35,366,151 (GRCm39)	D1117A	probably damaging	Het
Col12a1	A	T	9: 79,509,533 (GRCm39)	C3042S	probably benign	Het
Ctc1	G	A	11: 68,918,527 (GRCm39)	V265I	possibly damaging	Het
Cubn	T	C	2: 13,480,961 (GRCm39)	Y298C	probably damaging	Het
F2rl2	T	A	13: 95,833,585 (GRCm39)	I5N	possibly damaging	Het
Gpr137c	A	G	14: 45,516,420 (GRCm39)	Y336C	probably damaging	Het
Gstm6	T	A	3: 107,850,922 (GRCm39)	I10F	possibly damaging	Het
Hivep3	T	A	4: 119,955,705 (GRCm39)	C1340*	probably null	Het
Igf1	A	G	10: 87,700,683 (GRCm39)	T36A	probably damaging	Het
Lrch1	T	A	14: 75,044,985 (GRCm39)		probably benign	Het
Mrpl40	A	T	16: 18,691,125 (GRCm39)	I195N	probably damaging	Het
Myg1	G	C	15: 102,246,171 (GRCm39)	G349R	probably damaging	Het
Ndufc1	A	C	3: 51,315,564 (GRCm39)		probably null	Het
Nfasc	T	C	1: 132,523,392 (GRCm39)	N973S	possibly damaging	Het
Or4f62	G	A	2: 111,986,787 (GRCm39)	V164I	probably benign	Het
Or51a43	G	A	7: 103,717,675 (GRCm39)	R188*	probably null	Het
Or6c212	T	C	10: 129,558,652 (GRCm39)	I254V	probably benign	Het
Or9g19	A	T	2: 85,600,322 (GRCm39)	Y59F	probably damaging	Het
Pkdrej	C	A	15: 85,701,773 (GRCm39)	E1388*	probably null	Het
Prrc2b	T	A	2: 32,106,067 (GRCm39)	D1482E	probably benign	Het
Relch	C	T	1: 105,673,851 (GRCm39)	S1080L	possibly damaging	Het
Sppl2a	A	T	2: 126,754,615 (GRCm39)	S403R	possibly damaging	Het
Tespa1	A	G	10: 130,197,944 (GRCm39)	D322G	probably damaging	Het
Tmcc2	C	T	1: 132,288,569 (GRCm39)	V373M	probably damaging	Het
Ttn	T	C	2: 76,644,517 (GRCm39)	N13079S	possibly damaging	Het
Wdr53	A	G	16: 32,071,008 (GRCm39)	I118V	probably benign	Het
Zdbf2	T	C	1: 63,344,774 (GRCm39)	M1051T	probably benign	Het
Zfp784	G	C	7: 5,041,357 (GRCm39)		probably benign	Het

Other mutations in Dmtn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01802:Dmtn	APN	14	70,842,259 (GRCm39)	missense	probably damaging	1.00
IGL02836:Dmtn	APN	14	70,853,518 (GRCm39)	missense	probably damaging	1.00
R1248:Dmtn	UTSW	14	70,850,098 (GRCm39)	splice site	probably benign
R3438:Dmtn	UTSW	14	70,850,156 (GRCm39)	missense	probably damaging	0.98
R4851:Dmtn	UTSW	14	70,842,254 (GRCm39)	missense	probably damaging	1.00
R4917:Dmtn	UTSW	14	70,843,159 (GRCm39)	missense	probably damaging	0.98
R4924:Dmtn	UTSW	14	70,855,399 (GRCm39)	missense	probably benign	0.25
R5633:Dmtn	UTSW	14	70,842,419 (GRCm39)	missense	probably benign	0.18
R6170:Dmtn	UTSW	14	70,854,795 (GRCm39)	missense	probably damaging	1.00
R6214:Dmtn	UTSW	14	70,850,776 (GRCm39)	missense	probably benign	0.05
R6215:Dmtn	UTSW	14	70,850,776 (GRCm39)	missense	probably benign	0.05
R6639:Dmtn	UTSW	14	70,854,870 (GRCm39)	missense	probably damaging	1.00
R6860:Dmtn	UTSW	14	70,852,322 (GRCm39)	missense	possibly damaging	0.94
R7139:Dmtn	UTSW	14	70,854,867 (GRCm39)	missense	probably benign	0.12
R7242:Dmtn	UTSW	14	70,855,460 (GRCm39)	missense	probably damaging	1.00
R7380:Dmtn	UTSW	14	70,854,768 (GRCm39)	missense	probably damaging	0.99
R7572:Dmtn	UTSW	14	70,842,777 (GRCm39)	missense	possibly damaging	0.93
R8806:Dmtn	UTSW	14	70,852,388 (GRCm39)	missense	probably benign	0.26
R8888:Dmtn	UTSW	14	70,850,144 (GRCm39)	missense	probably benign	0.18
R8895:Dmtn	UTSW	14	70,850,144 (GRCm39)	missense	probably benign	0.18
R9027:Dmtn	UTSW	14	70,853,555 (GRCm39)	missense	probably damaging	0.99
R9032:Dmtn	UTSW	14	70,853,534 (GRCm39)	missense	probably damaging	0.99
R9085:Dmtn	UTSW	14	70,853,534 (GRCm39)	missense	probably damaging	0.99
R9694:Dmtn	UTSW	14	70,852,732 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTTAGACTGGCTCTGGGGAC -3'
(R):5'- AAGGGTCTTACTCTCCAGGG -3'

Sequencing Primer
(F):5'- TGGGGACAGAATATTTATCACCTAG -3'
(R):5'- GACTAAGCATTCAAATATATGGGGCC -3'

Posted On

2014-11-12