Incidental Mutation 'R2430:Prdm2'
ID 250372
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene Name PR domain containing 2, with ZNF domain
Synonyms KMT8, LOC381568, Riz, E330024L24Rik, 4833427P12Rik, Riz1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2430 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 142833961-142939560 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 142859733 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1186 (S1186P)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
AlphaFold A2A7B5
Predicted Effect possibly damaging
Transcript: ENSMUST00000105778
AA Change: S1186P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S1186P

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197026
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,543,740 (GRCm39) E161G probably benign Het
Ass1 A G 2: 31,391,508 (GRCm39) H261R probably damaging Het
Car11 T A 7: 45,353,072 (GRCm39) probably null Het
Crebbp T C 16: 3,914,329 (GRCm39) H844R probably damaging Het
Dnai2 A G 11: 114,648,012 (GRCm39) probably benign Het
Eya2 T C 2: 165,558,050 (GRCm39) probably null Het
Klhl40 A G 9: 121,609,667 (GRCm39) D484G possibly damaging Het
Knstrn A G 2: 118,664,584 (GRCm39) probably benign Het
Nckap5 A G 1: 125,842,494 (GRCm39) S1838P probably damaging Het
Nipsnap2 A G 5: 129,821,855 (GRCm39) D117G possibly damaging Het
Nudt15 C T 14: 73,762,742 (GRCm39) probably benign Het
Or5w16 T A 2: 87,576,999 (GRCm39) M153K possibly damaging Het
Or8k35 A G 2: 86,425,052 (GRCm39) I40T probably benign Het
Pcdh20 T C 14: 88,704,984 (GRCm39) D772G probably damaging Het
Pdss1 T A 2: 22,819,605 (GRCm39) Y289* probably null Het
Phc2 A T 4: 128,601,776 (GRCm39) Y77F probably damaging Het
Ppip5k2 A T 1: 97,662,755 (GRCm39) Y667N probably damaging Het
Prr36 A T 8: 4,263,488 (GRCm39) probably benign Het
Reck C T 4: 43,930,202 (GRCm39) T592I possibly damaging Het
Rprd2 T A 3: 95,672,107 (GRCm39) K1015* probably null Het
Tfrc T G 16: 32,445,529 (GRCm39) Y617D probably damaging Het
Tnfsf11 A C 14: 78,521,752 (GRCm39) D152E probably benign Het
Vmn2r54 T A 7: 12,365,933 (GRCm39) I334F probably damaging Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 142,860,329 (GRCm39) missense probably damaging 0.99
IGL00843:Prdm2 APN 4 142,860,884 (GRCm39) missense probably damaging 1.00
IGL01419:Prdm2 APN 4 142,860,218 (GRCm39) missense probably damaging 0.99
IGL01662:Prdm2 APN 4 142,860,138 (GRCm39) missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 142,860,974 (GRCm39) missense probably damaging 1.00
IGL02104:Prdm2 APN 4 142,859,997 (GRCm39) missense probably benign 0.01
IGL02208:Prdm2 APN 4 142,862,313 (GRCm39) missense probably benign 0.01
IGL02260:Prdm2 APN 4 142,861,157 (GRCm39) missense probably damaging 1.00
IGL02479:Prdm2 APN 4 142,861,499 (GRCm39) missense probably damaging 1.00
IGL02943:Prdm2 APN 4 142,858,542 (GRCm39) missense probably benign
IGL02972:Prdm2 APN 4 142,858,736 (GRCm39) missense probably benign
IGL03038:Prdm2 APN 4 142,860,571 (GRCm39) missense probably damaging 1.00
IGL03399:Prdm2 APN 4 142,861,658 (GRCm39) missense probably benign 0.07
G1patch:Prdm2 UTSW 4 142,859,471 (GRCm39) missense possibly damaging 0.96
PIT4677001:Prdm2 UTSW 4 142,861,648 (GRCm39) missense probably damaging 1.00
R0088:Prdm2 UTSW 4 142,861,524 (GRCm39) missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 142,860,338 (GRCm39) missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 142,905,921 (GRCm39) missense probably damaging 1.00
R0384:Prdm2 UTSW 4 142,862,258 (GRCm39) missense probably benign 0.01
R0400:Prdm2 UTSW 4 142,838,240 (GRCm39) missense probably benign
R0658:Prdm2 UTSW 4 142,861,835 (GRCm39) missense probably damaging 1.00
R0850:Prdm2 UTSW 4 142,858,773 (GRCm39) missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 142,858,953 (GRCm39) missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 142,858,533 (GRCm39) missense probably benign 0.33
R1519:Prdm2 UTSW 4 142,862,153 (GRCm39) missense probably damaging 1.00
R1936:Prdm2 UTSW 4 142,861,032 (GRCm39) missense probably benign 0.00
R1987:Prdm2 UTSW 4 142,859,079 (GRCm39) missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 142,858,447 (GRCm39) missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 142,861,517 (GRCm39) missense probably damaging 1.00
R2030:Prdm2 UTSW 4 142,859,334 (GRCm39) missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 142,858,506 (GRCm39) missense probably benign
R2221:Prdm2 UTSW 4 142,861,469 (GRCm39) missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 142,861,469 (GRCm39) missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 142,838,320 (GRCm39) nonsense probably null
R2484:Prdm2 UTSW 4 142,861,776 (GRCm39) missense probably damaging 1.00
R3735:Prdm2 UTSW 4 142,860,929 (GRCm39) missense probably damaging 1.00
R3944:Prdm2 UTSW 4 142,858,385 (GRCm39) missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 142,861,007 (GRCm39) missense probably damaging 1.00
R4411:Prdm2 UTSW 4 142,860,240 (GRCm39) missense probably benign 0.18
R4647:Prdm2 UTSW 4 142,859,525 (GRCm39) missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 142,860,761 (GRCm39) missense probably damaging 1.00
R5032:Prdm2 UTSW 4 142,905,937 (GRCm39) nonsense probably null
R5181:Prdm2 UTSW 4 142,861,536 (GRCm39) missense probably benign 0.35
R5513:Prdm2 UTSW 4 142,862,463 (GRCm39) small deletion probably benign
R5539:Prdm2 UTSW 4 142,859,264 (GRCm39) missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 142,861,200 (GRCm39) missense probably benign 0.09
R5618:Prdm2 UTSW 4 142,860,107 (GRCm39) missense probably benign 0.00
R5900:Prdm2 UTSW 4 142,861,290 (GRCm39) missense probably damaging 1.00
R5990:Prdm2 UTSW 4 142,896,683 (GRCm39) missense probably damaging 1.00
R6148:Prdm2 UTSW 4 142,859,477 (GRCm39) missense probably benign 0.33
R6166:Prdm2 UTSW 4 142,861,306 (GRCm39) missense probably damaging 0.99
R6223:Prdm2 UTSW 4 142,868,777 (GRCm39) missense probably benign 0.41
R6530:Prdm2 UTSW 4 142,860,617 (GRCm39) missense probably benign 0.05
R6631:Prdm2 UTSW 4 142,861,454 (GRCm39) missense probably benign 0.05
R6725:Prdm2 UTSW 4 142,859,471 (GRCm39) missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 142,859,520 (GRCm39) missense probably benign 0.18
R7193:Prdm2 UTSW 4 142,907,464 (GRCm39) missense probably damaging 1.00
R7238:Prdm2 UTSW 4 142,862,391 (GRCm39) missense probably benign 0.35
R7292:Prdm2 UTSW 4 142,859,471 (GRCm39) missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 142,905,869 (GRCm39) missense probably damaging 1.00
R7748:Prdm2 UTSW 4 142,862,459 (GRCm39) missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 142,861,140 (GRCm39) missense probably benign 0.41
R7936:Prdm2 UTSW 4 142,862,434 (GRCm39) missense probably damaging 0.99
R7976:Prdm2 UTSW 4 142,859,812 (GRCm39) nonsense probably null
R8124:Prdm2 UTSW 4 142,861,835 (GRCm39) missense probably damaging 1.00
R8150:Prdm2 UTSW 4 142,859,303 (GRCm39) missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 142,861,338 (GRCm39) missense probably benign 0.01
R8178:Prdm2 UTSW 4 142,859,018 (GRCm39) missense probably benign 0.33
R8235:Prdm2 UTSW 4 142,859,037 (GRCm39) nonsense probably null
R8404:Prdm2 UTSW 4 142,861,584 (GRCm39) missense probably damaging 0.98
R8498:Prdm2 UTSW 4 142,907,467 (GRCm39) missense probably damaging 1.00
R8502:Prdm2 UTSW 4 142,861,584 (GRCm39) missense probably damaging 0.98
R8688:Prdm2 UTSW 4 142,838,310 (GRCm39) missense probably benign
R8732:Prdm2 UTSW 4 142,862,580 (GRCm39) missense probably benign 0.00
R8796:Prdm2 UTSW 4 142,860,017 (GRCm39) missense probably benign 0.33
R8874:Prdm2 UTSW 4 142,859,785 (GRCm39) missense possibly damaging 0.70
R8887:Prdm2 UTSW 4 142,860,771 (GRCm39) missense probably damaging 1.00
R9119:Prdm2 UTSW 4 142,858,449 (GRCm39) nonsense probably null
R9139:Prdm2 UTSW 4 142,858,752 (GRCm39) missense probably benign 0.03
R9165:Prdm2 UTSW 4 142,858,674 (GRCm39) missense possibly damaging 0.73
R9342:Prdm2 UTSW 4 142,861,478 (GRCm39) missense probably damaging 1.00
R9518:Prdm2 UTSW 4 142,860,579 (GRCm39) missense possibly damaging 0.94
R9546:Prdm2 UTSW 4 142,861,561 (GRCm39) missense probably damaging 1.00
R9547:Prdm2 UTSW 4 142,861,561 (GRCm39) missense probably damaging 1.00
R9680:Prdm2 UTSW 4 142,859,079 (GRCm39) missense possibly damaging 0.73
R9730:Prdm2 UTSW 4 142,858,659 (GRCm39) missense possibly damaging 0.73
X0017:Prdm2 UTSW 4 142,861,277 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCGTGTAAAGCTCTTCAGAGG -3'
(R):5'- AATGTGTGCGCATCACCTTTTC -3'

Sequencing Primer
(F):5'- GCTCTTCAGAGGAGTCATTTAACTC -3'
(R):5'- GCATCACCTTTTCTTTCCATTAAAG -3'
Posted On 2014-11-12