Incidental Mutation 'R2432:Macf1'
ID250437
Institutional Source Beutler Lab
Gene Symbol Macf1
Ensembl Gene ENSMUSG00000028649
Gene Namemicrotubule-actin crosslinking factor 1
Synonymstrabeculin alpha, Acf7, Aclp7
MMRRC Submission 040393-MU
Accession Numbers

Ncbi RefSeq: NM_001199136.1, NM_001199137.1; MGI:108559

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2432 (G1)
Quality Score202
Status Validated
Chromosome4
Chromosomal Location123349633-123684360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123683996 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 65 (A65E)
Ref Sequence ENSEMBL: ENSMUSP00000101831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106224]
Predicted Effect probably damaging
Transcript: ENSMUST00000082108
AA Change: A65E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649
AA Change: A65E

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
SPEC 1550 1658 3.94e-3 SMART
SPEC 1818 1928 4.03e-9 SMART
SPEC 1935 2041 1.75e-9 SMART
SPEC 2048 2150 5.57e-3 SMART
SPEC 2157 2256 4.56e0 SMART
SPEC 2263 2394 3.46e-1 SMART
SPEC 2401 2506 1.29e-7 SMART
SPEC 2513 2617 1.19e-2 SMART
SPEC 2624 2727 2.7e-1 SMART
SPEC 2734 2837 4.99e-14 SMART
SPEC 2844 2944 1.9e-5 SMART
SPEC 2951 3057 2.83e0 SMART
SPEC 3060 3162 2.14e-4 SMART
SPEC 3169 3273 3.01e-8 SMART
SPEC 3280 3382 4.48e-16 SMART
SPEC 3389 3491 1.26e-10 SMART
SPEC 3498 3600 2.26e-3 SMART
SPEC 3607 3709 4.29e-4 SMART
SPEC 3716 3817 9.99e-14 SMART
SPEC 3824 3930 5.79e-2 SMART
SPEC 3937 4039 6.59e-14 SMART
SPEC 4046 4149 3.7e-17 SMART
SPEC 4156 4258 1.16e-23 SMART
SPEC 4265 4368 3.58e-15 SMART
SPEC 4375 4477 2.61e-17 SMART
SPEC 4484 4587 9.38e-19 SMART
SPEC 4594 4695 2.29e-22 SMART
SPEC 4702 4804 4.99e-14 SMART
SPEC 4811 4941 1.45e-10 SMART
EFh 4979 5007 5.08e-3 SMART
EFh 5015 5043 1.17e-2 SMART
GAS2 5054 5132 8.5e-54 SMART
low complexity region 5154 5199 N/A INTRINSIC
low complexity region 5248 5273 N/A INTRINSIC
low complexity region 5290 5302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084301
AA Change: A65E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649
AA Change: A65E

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 2.8e-30 SMART
CH 196 293 3.6e-26 SMART
SPEC 317 420 2.6e-2 SMART
SPEC 583 680 2.7e-11 SMART
SPEC 683 783 3.6e-7 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 1.5e-2 SMART
SPEC 1425 1533 6.9e-10 SMART
PLEC 1530 1576 5.3e-6 SMART
PLEC 1577 1614 1.2e-2 SMART
PLEC 1616 1653 8.7e-2 SMART
PLEC 1654 1691 8.3e-2 SMART
PLEC 1695 1729 1.3e-1 SMART
PLEC 1731 1767 1.4e-4 SMART
PLEC 1768 1805 2e-12 SMART
PLEC 1808 1843 5.2e-4 SMART
PLEC 1844 1881 4e-2 SMART
PLEC 1884 1919 1.9e0 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 4.5e-6 SMART
PLEC 2347 2388 1.7e-7 SMART
PLEC 2389 2426 1.2e-5 SMART
PLEC 2447 2484 6.3e-3 SMART
PLEC 2485 2522 2.1e-4 SMART
PLEC 2523 2561 1.5e-1 SMART
PLEC 2586 2633 3.1e-1 SMART
PLEC 2671 2708 6.5e-10 SMART
PLEC 2709 2746 2.3e-3 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3683 7.1e-3 SMART
SPEC 3841 3951 2.6e-11 SMART
SPEC 3958 4064 1.1e-11 SMART
SPEC 4071 4173 3.6e-5 SMART
SPEC 4180 4279 2.9e-2 SMART
SPEC 4286 4417 2.2e-3 SMART
SPEC 4424 4529 8.2e-10 SMART
SPEC 4536 4640 7.4e-5 SMART
SPEC 4647 4750 1.7e-3 SMART
SPEC 4757 4860 3.2e-16 SMART
SPEC 4867 4967 1.2e-7 SMART
SPEC 4974 5080 1.8e-2 SMART
SPEC 5083 5185 1.3e-6 SMART
SPEC 5192 5296 2e-10 SMART
SPEC 5303 5405 2.8e-18 SMART
SPEC 5412 5514 7.7e-13 SMART
SPEC 5521 5623 1.5e-5 SMART
SPEC 5630 5732 2.7e-6 SMART
SPEC 5739 5840 6.1e-16 SMART
SPEC 5847 5953 3.6e-4 SMART
SPEC 5960 6062 4.1e-16 SMART
SPEC 6069 6172 2.4e-19 SMART
SPEC 6179 6281 7.6e-26 SMART
SPEC 6288 6391 2.2e-17 SMART
SPEC 6398 6500 1.6e-19 SMART
SPEC 6507 6610 5.7e-21 SMART
SPEC 6617 6718 1.5e-24 SMART
SPEC 6725 6827 3.2e-16 SMART
SPEC 6834 6964 9.4e-13 SMART
EFh 7002 7030 2.4e-5 SMART
EFh 7038 7066 5.8e-5 SMART
GAS2 7077 7155 5.5e-56 SMART
low complexity region 7177 7222 N/A INTRINSIC
low complexity region 7271 7296 N/A INTRINSIC
low complexity region 7313 7325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097897
AA Change: A65E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649
AA Change: A65E

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4644 1.19e-2 SMART
SPEC 4651 4754 2.7e-1 SMART
SPEC 4761 4864 4.99e-14 SMART
SPEC 4871 4971 1.9e-5 SMART
SPEC 4978 5084 2.83e0 SMART
SPEC 5087 5189 2.14e-4 SMART
SPEC 5196 5300 3.01e-8 SMART
SPEC 5307 5409 4.48e-16 SMART
SPEC 5416 5518 1.26e-10 SMART
SPEC 5525 5627 2.26e-3 SMART
SPEC 5634 5736 4.29e-4 SMART
SPEC 5743 5844 9.99e-14 SMART
SPEC 5851 5957 5.79e-2 SMART
SPEC 5964 6066 6.59e-14 SMART
SPEC 6073 6176 3.7e-17 SMART
SPEC 6183 6285 1.16e-23 SMART
SPEC 6292 6395 3.58e-15 SMART
SPEC 6402 6504 2.61e-17 SMART
SPEC 6511 6614 9.38e-19 SMART
SPEC 6621 6722 2.29e-22 SMART
SPEC 6729 6831 4.99e-14 SMART
SPEC 6838 6968 1.45e-10 SMART
EFh 7006 7034 5.08e-3 SMART
EFh 7042 7070 1.17e-2 SMART
GAS2 7081 7159 8.5e-54 SMART
low complexity region 7181 7226 N/A INTRINSIC
low complexity region 7275 7300 N/A INTRINSIC
low complexity region 7317 7329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106224
AA Change: A65E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649
AA Change: A65E

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4642 9.34e-2 SMART
SPEC 4649 4752 2.7e-1 SMART
SPEC 4759 4862 4.99e-14 SMART
SPEC 4869 4969 1.9e-5 SMART
SPEC 4976 5082 2.83e0 SMART
SPEC 5085 5187 2.14e-4 SMART
SPEC 5194 5298 3.01e-8 SMART
SPEC 5305 5407 4.48e-16 SMART
SPEC 5414 5516 1.26e-10 SMART
SPEC 5523 5625 2.26e-3 SMART
SPEC 5632 5734 4.29e-4 SMART
SPEC 5741 5842 9.99e-14 SMART
SPEC 5849 5955 5.79e-2 SMART
SPEC 5962 6064 6.59e-14 SMART
SPEC 6071 6174 3.7e-17 SMART
SPEC 6181 6283 1.16e-23 SMART
SPEC 6290 6393 3.58e-15 SMART
SPEC 6400 6502 2.61e-17 SMART
SPEC 6509 6612 9.38e-19 SMART
SPEC 6619 6720 2.29e-22 SMART
SPEC 6727 6829 4.99e-14 SMART
SPEC 6836 6966 1.45e-10 SMART
EFh 7004 7032 5.08e-3 SMART
EFh 7040 7068 1.17e-2 SMART
GAS2 7079 7157 8.5e-54 SMART
low complexity region 7179 7224 N/A INTRINSIC
low complexity region 7273 7298 N/A INTRINSIC
low complexity region 7315 7327 N/A INTRINSIC
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (53/53)
MGI Phenotype Strain: 3652899; 4831019
Lethality: E7-E8
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,451,333 probably benign Het
Adamts6 A T 13: 104,426,977 Y659F probably benign Het
Adamts9 C A 6: 92,857,900 G750W probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Aspscr1 A G 11: 120,702,566 probably benign Het
Calr3 A G 8: 72,438,426 probably benign Het
Cpt2 A T 4: 107,904,526 Y126* probably null Het
Cyp2d34 A G 15: 82,619,011 L94P probably damaging Het
Def6 A T 17: 28,228,069 D558V probably benign Het
Dnase1l2 G A 17: 24,442,725 T20I possibly damaging Het
Eif5b A G 1: 38,019,342 K242E unknown Het
Golim4 T C 3: 75,891,942 N478S possibly damaging Het
Helb A T 10: 120,105,537 D415E probably benign Het
Ifna12 T A 4: 88,603,353 probably benign Het
Jhy T A 9: 40,960,886 H109L probably benign Het
Krt83 A T 15: 101,488,156 Y241* probably null Het
Mug2 C A 6: 122,084,376 N1418K possibly damaging Het
Myo1f A G 17: 33,575,849 D21G probably damaging Het
Myo5a T A 9: 75,212,873 I1651N possibly damaging Het
Notch3 A T 17: 32,153,804 C598S probably damaging Het
Npat A T 9: 53,558,135 H307L probably damaging Het
Nr1h2 T C 7: 44,551,367 Q279R possibly damaging Het
Olfr1302 T C 2: 111,780,671 V117A probably benign Het
Olfr804 A G 10: 129,704,925 T16A possibly damaging Het
Pcdhb16 A T 18: 37,479,930 N648Y probably damaging Het
Pdzrn3 G T 6: 101,150,791 S971R probably damaging Het
Plch2 A G 4: 154,986,164 *494Q probably null Het
Plekhg4 T A 8: 105,381,836 D1170E probably benign Het
Plekhm3 A G 1: 64,937,856 S152P probably damaging Het
Ppargc1b G A 18: 61,307,799 P683S possibly damaging Het
Prdm12 T G 2: 31,651,852 M191R probably benign Het
Prdm14 T C 1: 13,125,633 D68G probably benign Het
Prp2 C T 6: 132,599,911 P54S unknown Het
Prpf4b A G 13: 34,883,341 probably benign Het
Ptprk T A 10: 28,592,844 V1408E probably damaging Het
Rap1gds1 A G 3: 138,956,250 M415T probably damaging Het
Rps6ka5 A G 12: 100,554,405 F621S probably damaging Het
Rrm1 T A 7: 102,443,072 D35E probably benign Het
Rxfp3 T C 15: 11,036,140 H382R probably damaging Het
Slc11a1 A G 1: 74,383,751 probably benign Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc30a3 T C 5: 31,088,694 S231G probably damaging Het
Slc44a2 A T 9: 21,344,834 I274F probably damaging Het
Tas2r119 A G 15: 32,178,019 I244V possibly damaging Het
Tenm2 C A 11: 36,027,191 R1914L probably damaging Het
Tfdp2 T C 9: 96,310,590 M242T probably damaging Het
Tmprss6 A G 15: 78,465,104 probably benign Het
Ttc6 C T 12: 57,622,035 P421L possibly damaging Het
Usp16 T A 16: 87,466,358 probably null Het
Usp40 T C 1: 87,982,082 E550G probably benign Het
Vmn2r28 T C 7: 5,488,702 Y182C probably damaging Het
Zfp382 A G 7: 30,133,749 D275G probably benign Het
Other mutations in Macf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Macf1 APN 4 123382122 missense probably damaging 0.99
IGL01293:Macf1 APN 4 123471311 missense probably benign 0.00
IGL01307:Macf1 APN 4 123383129 missense probably damaging 1.00
IGL01314:Macf1 APN 4 123486720 missense probably damaging 1.00
IGL01321:Macf1 APN 4 123440774 missense probably damaging 1.00
IGL01327:Macf1 APN 4 123509912 missense probably benign 0.20
IGL01365:Macf1 APN 4 123391169 missense probably damaging 1.00
IGL01465:Macf1 APN 4 123490721 missense probably benign 0.00
IGL01527:Macf1 APN 4 123493160 missense possibly damaging 0.93
IGL01533:Macf1 APN 4 123473873 missense probably damaging 1.00
IGL01539:Macf1 APN 4 123395908 splice site probably benign
IGL01543:Macf1 APN 4 123401457 missense probably damaging 1.00
IGL01553:Macf1 APN 4 123493163 nonsense probably null
IGL01558:Macf1 APN 4 123453005 missense probably benign 0.00
IGL01633:Macf1 APN 4 123502171 missense probably damaging 0.99
IGL01684:Macf1 APN 4 123465930 missense probably damaging 1.00
IGL01715:Macf1 APN 4 123391086 missense probably damaging 1.00
IGL01844:Macf1 APN 4 123440692 missense probably benign 0.34
IGL01870:Macf1 APN 4 123474113 missense probably damaging 0.99
IGL01916:Macf1 APN 4 123441630 missense probably damaging 1.00
IGL01916:Macf1 APN 4 123476037 missense probably damaging 1.00
IGL01923:Macf1 APN 4 123380444 missense possibly damaging 0.46
IGL02017:Macf1 APN 4 123499931 missense probably damaging 1.00
IGL02022:Macf1 APN 4 123391049 critical splice donor site probably null
IGL02084:Macf1 APN 4 123432603 missense probably benign 0.02
IGL02084:Macf1 APN 4 123459374 missense probably damaging 1.00
IGL02142:Macf1 APN 4 123472049 missense probably benign 0.11
IGL02151:Macf1 APN 4 123371766 splice site probably benign
IGL02164:Macf1 APN 4 123480272 missense probably benign 0.03
IGL02174:Macf1 APN 4 123491794 missense probably damaging 1.00
IGL02229:Macf1 APN 4 123509826 missense probably damaging 1.00
IGL02277:Macf1 APN 4 123486704 missense probably damaging 1.00
IGL02283:Macf1 APN 4 123471375 missense probably benign 0.01
IGL02314:Macf1 APN 4 123444837 missense probably damaging 0.99
IGL02327:Macf1 APN 4 123471730 missense probably benign 0.06
IGL02348:Macf1 APN 4 123512866 missense probably damaging 1.00
IGL02441:Macf1 APN 4 123387236 missense probably damaging 1.00
IGL02585:Macf1 APN 4 123472284 missense probably benign 0.00
IGL02602:Macf1 APN 4 123355163 missense probably damaging 1.00
IGL03204:Macf1 APN 4 123355277 splice site probably benign
Royal_flush UTSW 4 123365355 splice site probably null
suspension UTSW 4 123497755 missense probably damaging 1.00
voragine UTSW 4 123355102 missense probably damaging 1.00
H8562:Macf1 UTSW 4 123466040 missense probably benign 0.13
IGL03052:Macf1 UTSW 4 123387395 missense probably damaging 1.00
N/A - 535:Macf1 UTSW 4 123473808 missense possibly damaging 0.82
PIT4576001:Macf1 UTSW 4 123473321 missense probably benign 0.43
R0021:Macf1 UTSW 4 123475577 missense probably damaging 1.00
R0023:Macf1 UTSW 4 123488314 splice site probably benign
R0023:Macf1 UTSW 4 123488314 splice site probably benign
R0028:Macf1 UTSW 4 123382102 missense probably damaging 1.00
R0066:Macf1 UTSW 4 123432150 nonsense probably null
R0066:Macf1 UTSW 4 123432150 nonsense probably null
R0067:Macf1 UTSW 4 123475248 missense possibly damaging 0.90
R0067:Macf1 UTSW 4 123475248 missense possibly damaging 0.90
R0078:Macf1 UTSW 4 123473868 missense probably damaging 1.00
R0106:Macf1 UTSW 4 123408564 missense probably benign 0.00
R0123:Macf1 UTSW 4 123432843 missense possibly damaging 0.78
R0129:Macf1 UTSW 4 123433275 missense probably damaging 1.00
R0134:Macf1 UTSW 4 123432843 missense possibly damaging 0.78
R0138:Macf1 UTSW 4 123440747 missense probably damaging 1.00
R0145:Macf1 UTSW 4 123387397 missense probably damaging 1.00
R0195:Macf1 UTSW 4 123434916 missense probably damaging 0.99
R0227:Macf1 UTSW 4 123399391 missense probably benign 0.14
R0233:Macf1 UTSW 4 123450127 splice site probably benign
R0254:Macf1 UTSW 4 123432779 missense probably damaging 1.00
R0357:Macf1 UTSW 4 123457983 missense probably damaging 1.00
R0398:Macf1 UTSW 4 123351017 missense probably damaging 1.00
R0413:Macf1 UTSW 4 123472269 missense probably benign
R0426:Macf1 UTSW 4 123483660 nonsense probably null
R0441:Macf1 UTSW 4 123365355 splice site probably null
R0453:Macf1 UTSW 4 123444944 missense probably benign 0.35
R0481:Macf1 UTSW 4 123484022 splice site probably null
R0502:Macf1 UTSW 4 123469815 missense probably damaging 1.00
R0503:Macf1 UTSW 4 123469815 missense probably damaging 1.00
R0519:Macf1 UTSW 4 123471320 missense probably benign 0.03
R0543:Macf1 UTSW 4 123376378 missense probably damaging 1.00
R0621:Macf1 UTSW 4 123380534 missense probably damaging 1.00
R0631:Macf1 UTSW 4 123455524 nonsense probably null
R0720:Macf1 UTSW 4 123432925 missense probably damaging 1.00
R0730:Macf1 UTSW 4 123382530 splice site probably benign
R0755:Macf1 UTSW 4 123369926 missense probably damaging 0.99
R0836:Macf1 UTSW 4 123494882 critical splice donor site probably null
R0847:Macf1 UTSW 4 123399366 missense probably benign 0.03
R0850:Macf1 UTSW 4 123474402 missense probably benign
R0924:Macf1 UTSW 4 123385478 missense probably damaging 1.00
R0973:Macf1 UTSW 4 123476000 missense possibly damaging 0.76
R1025:Macf1 UTSW 4 123473816 missense probably damaging 1.00
R1076:Macf1 UTSW 4 123385598 missense probably damaging 1.00
R1253:Macf1 UTSW 4 123457967 missense probably damaging 1.00
R1301:Macf1 UTSW 4 123486658 splice site probably benign
R1337:Macf1 UTSW 4 123476275 missense probably benign 0.34
R1344:Macf1 UTSW 4 123433453 missense probably damaging 0.99
R1404:Macf1 UTSW 4 123376516 missense probably damaging 1.00
R1404:Macf1 UTSW 4 123376516 missense probably damaging 1.00
R1443:Macf1 UTSW 4 123511007 missense probably damaging 1.00
R1452:Macf1 UTSW 4 123493998 missense probably benign
R1465:Macf1 UTSW 4 123493154 missense probably damaging 0.98
R1465:Macf1 UTSW 4 123493154 missense probably damaging 0.98
R1483:Macf1 UTSW 4 123510977 missense probably damaging 1.00
R1509:Macf1 UTSW 4 123684009 missense possibly damaging 0.92
R1510:Macf1 UTSW 4 123434762 missense probably null 1.00
R1515:Macf1 UTSW 4 123378480 missense probably damaging 1.00
R1524:Macf1 UTSW 4 123432530 missense possibly damaging 0.75
R1528:Macf1 UTSW 4 123476014 missense probably benign 0.30
R1535:Macf1 UTSW 4 123440693 missense probably benign 0.05
R1556:Macf1 UTSW 4 123455020 missense probably damaging 1.00
R1564:Macf1 UTSW 4 123459357 missense probably benign 0.00
R1586:Macf1 UTSW 4 123509846 missense probably benign 0.20
R1626:Macf1 UTSW 4 123471534 missense probably benign
R1629:Macf1 UTSW 4 123508415 nonsense probably null
R1649:Macf1 UTSW 4 123484053 missense probably damaging 0.96
R1650:Macf1 UTSW 4 123456600 nonsense probably null
R1706:Macf1 UTSW 4 123370584 critical splice donor site probably null
R1713:Macf1 UTSW 4 123378694 missense probably damaging 1.00
R1716:Macf1 UTSW 4 123401403 missense probably damaging 1.00
R1744:Macf1 UTSW 4 123475853 missense probably damaging 1.00
R1752:Macf1 UTSW 4 123483672 missense possibly damaging 0.92
R1771:Macf1 UTSW 4 123512108 missense probably damaging 1.00
R1812:Macf1 UTSW 4 123432024 missense probably damaging 1.00
R1818:Macf1 UTSW 4 123376417 missense probably damaging 1.00
R1853:Macf1 UTSW 4 123512720 intron probably null
R1856:Macf1 UTSW 4 123369848 missense probably damaging 1.00
R1869:Macf1 UTSW 4 123351128 missense probably damaging 1.00
R1880:Macf1 UTSW 4 123438591 missense probably damaging 1.00
R1888:Macf1 UTSW 4 123455042 missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123474712 missense probably benign
R1888:Macf1 UTSW 4 123455042 missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123474712 missense probably benign
R1902:Macf1 UTSW 4 123471165 missense probably benign 0.01
R1907:Macf1 UTSW 4 123372399 missense probably damaging 1.00
R1908:Macf1 UTSW 4 123457841 missense possibly damaging 0.67
R1932:Macf1 UTSW 4 123452037 missense probably damaging 1.00
R1944:Macf1 UTSW 4 123370666 missense probably damaging 1.00
R1945:Macf1 UTSW 4 123490660 nonsense probably null
R1975:Macf1 UTSW 4 123489212 missense probably damaging 1.00
R1989:Macf1 UTSW 4 123497726 critical splice donor site probably null
R1991:Macf1 UTSW 4 123456695 missense probably damaging 1.00
R1992:Macf1 UTSW 4 123456695 missense probably damaging 1.00
R2013:Macf1 UTSW 4 123684014 missense probably damaging 1.00
R2021:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2022:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2023:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2024:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2025:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2027:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2049:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2060:Macf1 UTSW 4 123499919 unclassified probably null
R2092:Macf1 UTSW 4 123383178 missense probably damaging 1.00
R2100:Macf1 UTSW 4 123397906 nonsense probably null
R2128:Macf1 UTSW 4 123492774 missense probably benign 0.11
R2129:Macf1 UTSW 4 123368815 splice site probably benign
R2140:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2142:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2182:Macf1 UTSW 4 123492671 missense probably damaging 0.98
R2185:Macf1 UTSW 4 123475556 missense probably damaging 0.99
R2190:Macf1 UTSW 4 123459212 missense probably benign 0.11
R2320:Macf1 UTSW 4 123439495 missense probably benign 0.02
R2382:Macf1 UTSW 4 123374832 missense probably damaging 1.00
R2429:Macf1 UTSW 4 123432584 missense probably damaging 0.99
R2484:Macf1 UTSW 4 123473672 missense probably damaging 1.00
R2842:Macf1 UTSW 4 123376417 missense probably damaging 1.00
R2912:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2913:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2914:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2938:Macf1 UTSW 4 123432902 missense probably damaging 0.99
R3082:Macf1 UTSW 4 123361443 splice site probably null
R3086:Macf1 UTSW 4 123435108 missense probably benign 0.00
R3408:Macf1 UTSW 4 123381781 missense probably damaging 1.00
R3499:Macf1 UTSW 4 123527305 nonsense probably null
R3696:Macf1 UTSW 4 123456362 missense probably damaging 1.00
R3716:Macf1 UTSW 4 123473502 missense probably benign 0.01
R3727:Macf1 UTSW 4 123459311 missense probably damaging 1.00
R3770:Macf1 UTSW 4 123374767 missense probably damaging 1.00
R3813:Macf1 UTSW 4 123374767 missense probably damaging 1.00
R3825:Macf1 UTSW 4 123444951 missense probably benign 0.11
R3893:Macf1 UTSW 4 123486406 missense probably damaging 1.00
R3896:Macf1 UTSW 4 123471194 missense possibly damaging 0.55
R3947:Macf1 UTSW 4 123380420 missense probably damaging 1.00
R4031:Macf1 UTSW 4 123381312 missense probably damaging 1.00
R4052:Macf1 UTSW 4 123472017 missense probably benign 0.00
R4077:Macf1 UTSW 4 123472091 missense probably benign 0.07
R4078:Macf1 UTSW 4 123472091 missense probably benign 0.07
R4084:Macf1 UTSW 4 123450072 missense probably damaging 0.98
R4094:Macf1 UTSW 4 123459269 missense probably benign 0.00
R4154:Macf1 UTSW 4 123471813 missense probably damaging 1.00
R4190:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4191:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4192:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4232:Macf1 UTSW 4 123432392 missense probably damaging 1.00
R4299:Macf1 UTSW 4 123399406 missense probably damaging 1.00
R4326:Macf1 UTSW 4 123382212 missense probably damaging 1.00
R4327:Macf1 UTSW 4 123382212 missense probably damaging 1.00
R4355:Macf1 UTSW 4 123475091 missense possibly damaging 0.79
R4380:Macf1 UTSW 4 123354492 intron probably benign
R4422:Macf1 UTSW 4 123466046 missense probably damaging 0.96
R4436:Macf1 UTSW 4 123527342 missense probably benign 0.03
R4472:Macf1 UTSW 4 123395989 missense probably damaging 1.00
R4515:Macf1 UTSW 4 123493988 missense probably damaging 1.00
R4549:Macf1 UTSW 4 123473693 missense possibly damaging 0.75
R4621:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4622:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4623:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4630:Macf1 UTSW 4 123473639 missense possibly damaging 0.84
R4647:Macf1 UTSW 4 123473627 missense probably benign 0.01
R4650:Macf1 UTSW 4 123473619 missense probably benign 0.00
R4674:Macf1 UTSW 4 123472397 missense probably benign 0.22
R4751:Macf1 UTSW 4 123471650 missense probably benign 0.01
R4762:Macf1 UTSW 4 123455444 missense probably benign 0.00
R4776:Macf1 UTSW 4 123476015 missense probably benign 0.00
R4777:Macf1 UTSW 4 123376502 missense probably damaging 1.00
R4860:Macf1 UTSW 4 123486750 missense probably damaging 1.00
R4860:Macf1 UTSW 4 123486750 missense probably damaging 1.00
R4865:Macf1 UTSW 4 123433303 missense probably damaging 1.00
R4867:Macf1 UTSW 4 123472200 missense probably damaging 0.97
R4884:Macf1 UTSW 4 123455009 missense probably benign 0.02
R4890:Macf1 UTSW 4 123448238 missense probably damaging 1.00
R4913:Macf1 UTSW 4 123499889 missense probably damaging 1.00
R4925:Macf1 UTSW 4 123526652 missense probably benign
R4948:Macf1 UTSW 4 123497755 missense probably damaging 1.00
R4958:Macf1 UTSW 4 123475364 missense probably damaging 0.99
R4986:Macf1 UTSW 4 123391121 missense probably damaging 1.00
R4999:Macf1 UTSW 4 123494909 missense probably benign 0.14
R5004:Macf1 UTSW 4 123385475 missense probably damaging 1.00
R5017:Macf1 UTSW 4 123452113 missense probably damaging 1.00
R5018:Macf1 UTSW 4 123385599 missense probably damaging 1.00
R5026:Macf1 UTSW 4 123439494 missense possibly damaging 0.95
R5037:Macf1 UTSW 4 123455519 missense probably damaging 0.97
R5039:Macf1 UTSW 4 123511220 missense probably damaging 1.00
R5041:Macf1 UTSW 4 123397046 intron probably null
R5100:Macf1 UTSW 4 123474468 missense probably benign 0.11
R5110:Macf1 UTSW 4 123368008 missense probably damaging 0.99
R5122:Macf1 UTSW 4 123452292 missense probably damaging 1.00
R5187:Macf1 UTSW 4 123472089 missense probably benign 0.00
R5191:Macf1 UTSW 4 123472962 missense probably benign 0.00
R5201:Macf1 UTSW 4 123475945 nonsense probably null
R5236:Macf1 UTSW 4 123397821 missense probably damaging 1.00
R5248:Macf1 UTSW 4 123401774 nonsense probably null
R5251:Macf1 UTSW 4 123449967 missense probably benign 0.20
R5319:Macf1 UTSW 4 123473436 missense probably damaging 1.00
R5326:Macf1 UTSW 4 123350991 frame shift probably null
R5327:Macf1 UTSW 4 123350991 frame shift probably null
R5328:Macf1 UTSW 4 123350991 frame shift probably null
R5350:Macf1 UTSW 4 123527458 start codon destroyed probably null 0.02
R5390:Macf1 UTSW 4 123471753 missense probably damaging 0.98
R5419:Macf1 UTSW 4 123397124 missense possibly damaging 0.70
R5428:Macf1 UTSW 4 123384868 missense probably damaging 1.00
R5432:Macf1 UTSW 4 123459336 nonsense probably null
R5466:Macf1 UTSW 4 123452865 missense possibly damaging 0.75
R5472:Macf1 UTSW 4 123450061 missense probably benign
R5564:Macf1 UTSW 4 123526745 missense possibly damaging 0.92
R5566:Macf1 UTSW 4 123435164 missense probably damaging 0.98
R5597:Macf1 UTSW 4 123539777 intron probably benign
R5669:Macf1 UTSW 4 123476225 missense probably damaging 1.00
R5682:Macf1 UTSW 4 123434759 missense probably damaging 1.00
R5701:Macf1 UTSW 4 123503225 missense probably damaging 1.00
R5715:Macf1 UTSW 4 123684014 missense probably damaging 1.00
R5760:Macf1 UTSW 4 123513884 missense probably damaging 1.00
R5806:Macf1 UTSW 4 123371887 missense probably damaging 1.00
R5838:Macf1 UTSW 4 123452154 missense possibly damaging 0.95
R5839:Macf1 UTSW 4 123381324 missense probably damaging 1.00
R5850:Macf1 UTSW 4 123507306 missense probably damaging 1.00
R5875:Macf1 UTSW 4 123432314 missense possibly damaging 0.78
R5912:Macf1 UTSW 4 123397158 missense probably damaging 1.00
R5913:Macf1 UTSW 4 123476039 missense probably damaging 1.00
R5921:Macf1 UTSW 4 123526711 missense probably benign
R5940:Macf1 UTSW 4 123432881 missense probably damaging 1.00
R5950:Macf1 UTSW 4 123439436 splice site probably null
R6005:Macf1 UTSW 4 123474275 missense possibly damaging 0.82
R6029:Macf1 UTSW 4 123507333 missense probably damaging 1.00
R6041:Macf1 UTSW 4 123513848 missense probably damaging 1.00
R6057:Macf1 UTSW 4 123510743 missense probably damaging 0.98
R6156:Macf1 UTSW 4 123472280 missense probably benign 0.00
R6186:Macf1 UTSW 4 123484175 missense probably damaging 1.00
R6197:Macf1 UTSW 4 123452292 missense probably damaging 1.00
R6262:Macf1 UTSW 4 123473190 missense possibly damaging 0.79
R6296:Macf1 UTSW 4 123432875 missense probably damaging 1.00
R6340:Macf1 UTSW 4 123448249 missense probably benign 0.13
R6369:Macf1 UTSW 4 123410562 missense possibly damaging 0.90
R6414:Macf1 UTSW 4 123493195 missense possibly damaging 0.93
R6429:Macf1 UTSW 4 123401594 intron probably null
R6501:Macf1 UTSW 4 123469632 unclassified probably null
R6508:Macf1 UTSW 4 123469742 missense probably damaging 0.96
R6519:Macf1 UTSW 4 123472325 missense probably benign 0.13
R6535:Macf1 UTSW 4 123471935 missense possibly damaging 0.82
R6537:Macf1 UTSW 4 123492725 missense probably damaging 1.00
R6546:Macf1 UTSW 4 123432281 missense probably benign 0.14
R6583:Macf1 UTSW 4 123470946 intron probably null
R6597:Macf1 UTSW 4 123382692 missense probably damaging 1.00
R6693:Macf1 UTSW 4 123473808 missense possibly damaging 0.82
R6696:Macf1 UTSW 4 123509803 missense probably damaging 1.00
R6704:Macf1 UTSW 4 123410762 intron probably benign
R6716:Macf1 UTSW 4 123508438 missense probably damaging 1.00
R6789:Macf1 UTSW 4 123372438 missense probably damaging 1.00
R6807:Macf1 UTSW 4 123374415 missense probably damaging 1.00
R6825:Macf1 UTSW 4 123383222 splice site probably null
R6881:Macf1 UTSW 4 123432453 missense probably damaging 1.00
R6894:Macf1 UTSW 4 123483687 missense possibly damaging 0.89
R6924:Macf1 UTSW 4 123527352 missense possibly damaging 0.53
R6962:Macf1 UTSW 4 123440722 missense probably benign 0.01
R6965:Macf1 UTSW 4 123408745 missense probably benign 0.38
R6969:Macf1 UTSW 4 123457800 missense probably benign 0.01
R7032:Macf1 UTSW 4 123472308 missense probably benign 0.00
R7055:Macf1 UTSW 4 123409196 missense probably benign 0.01
R7078:Macf1 UTSW 4 123432143 missense probably damaging 0.99
R7215:Macf1 UTSW 4 123507304 missense probably damaging 1.00
R7263:Macf1 UTSW 4 123378150 missense probably damaging 1.00
R7265:Macf1 UTSW 4 123407877 missense probably benign 0.00
R7312:Macf1 UTSW 4 123506337 missense probably damaging 1.00
X0022:Macf1 UTSW 4 123450042 missense probably damaging 0.99
X0027:Macf1 UTSW 4 123503269 missense probably damaging 1.00
X0064:Macf1 UTSW 4 123511874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAGGGCAGTAGGCTTCC -3'
(R):5'- CCTCTGATGAAGAAACGCTCAG -3'

Sequencing Primer
(F):5'- CAGGGCAGTAGGCTTCCTTTTTC -3'
(R):5'- CTCAGTGAGCGATCCTGTC -3'
Posted On2014-11-12