Incidental Mutation 'R2432:Jhy'
ID250452
Institutional Source Beutler Lab
Gene Symbol Jhy
Ensembl Gene ENSMUSG00000032023
Gene Namejunctional cadherin complex regulator
Synonyms4931429I11Rik
MMRRC Submission 040393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R2432 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40894849-40964118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40960886 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 109 (H109L)
Ref Sequence ENSEMBL: ENSMUSP00000034521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034521] [ENSMUST00000160120]
Predicted Effect probably benign
Transcript: ENSMUST00000034521
AA Change: H109L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034521
Gene: ENSMUSG00000032023
AA Change: H109L

DomainStartEndE-ValueType
low complexity region 42 51 N/A INTRINSIC
low complexity region 71 85 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 383 398 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
Pfam:DUF4591 648 767 7.2e-38 PFAM
Predicted Effect silent
Transcript: ENSMUST00000160120
SMART Domains Protein: ENSMUSP00000124975
Gene: ENSMUSG00000032023

DomainStartEndE-ValueType
low complexity region 42 51 N/A INTRINSIC
low complexity region 71 85 N/A INTRINSIC
Meta Mutation Damage Score 0.1384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hydrocephalus, domed cranium, ataxia, weight loss, enlarged lateral ventricle, neuodegeneration, abnormal brain ependymal motile cilium and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,451,333 probably benign Het
Adamts6 A T 13: 104,426,977 Y659F probably benign Het
Adamts9 C A 6: 92,857,900 G750W probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Aspscr1 A G 11: 120,702,566 probably benign Het
Calr3 A G 8: 72,438,426 probably benign Het
Cpt2 A T 4: 107,904,526 Y126* probably null Het
Cyp2d34 A G 15: 82,619,011 L94P probably damaging Het
Def6 A T 17: 28,228,069 D558V probably benign Het
Dnase1l2 G A 17: 24,442,725 T20I possibly damaging Het
Eif5b A G 1: 38,019,342 K242E unknown Het
Golim4 T C 3: 75,891,942 N478S possibly damaging Het
Helb A T 10: 120,105,537 D415E probably benign Het
Ifna12 T A 4: 88,603,353 probably benign Het
Krt83 A T 15: 101,488,156 Y241* probably null Het
Macf1 G T 4: 123,683,996 A65E probably damaging Het
Mug2 C A 6: 122,084,376 N1418K possibly damaging Het
Myo1f A G 17: 33,575,849 D21G probably damaging Het
Myo5a T A 9: 75,212,873 I1651N possibly damaging Het
Notch3 A T 17: 32,153,804 C598S probably damaging Het
Npat A T 9: 53,558,135 H307L probably damaging Het
Nr1h2 T C 7: 44,551,367 Q279R possibly damaging Het
Olfr1302 T C 2: 111,780,671 V117A probably benign Het
Olfr804 A G 10: 129,704,925 T16A possibly damaging Het
Pcdhb16 A T 18: 37,479,930 N648Y probably damaging Het
Pdzrn3 G T 6: 101,150,791 S971R probably damaging Het
Plch2 A G 4: 154,986,164 *494Q probably null Het
Plekhg4 T A 8: 105,381,836 D1170E probably benign Het
Plekhm3 A G 1: 64,937,856 S152P probably damaging Het
Ppargc1b G A 18: 61,307,799 P683S possibly damaging Het
Prdm12 T G 2: 31,651,852 M191R probably benign Het
Prdm14 T C 1: 13,125,633 D68G probably benign Het
Prp2 C T 6: 132,599,911 P54S unknown Het
Prpf4b A G 13: 34,883,341 probably benign Het
Ptprk T A 10: 28,592,844 V1408E probably damaging Het
Rap1gds1 A G 3: 138,956,250 M415T probably damaging Het
Rps6ka5 A G 12: 100,554,405 F621S probably damaging Het
Rrm1 T A 7: 102,443,072 D35E probably benign Het
Rxfp3 T C 15: 11,036,140 H382R probably damaging Het
Slc11a1 A G 1: 74,383,751 probably benign Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc30a3 T C 5: 31,088,694 S231G probably damaging Het
Slc44a2 A T 9: 21,344,834 I274F probably damaging Het
Tas2r119 A G 15: 32,178,019 I244V possibly damaging Het
Tenm2 C A 11: 36,027,191 R1914L probably damaging Het
Tfdp2 T C 9: 96,310,590 M242T probably damaging Het
Tmprss6 A G 15: 78,465,104 probably benign Het
Ttc6 C T 12: 57,622,035 P421L possibly damaging Het
Usp16 T A 16: 87,466,358 probably null Het
Usp40 T C 1: 87,982,082 E550G probably benign Het
Vmn2r28 T C 7: 5,488,702 Y182C probably damaging Het
Zfp382 A G 7: 30,133,749 D275G probably benign Het
Other mutations in Jhy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Jhy APN 9 40922752 missense probably benign 0.00
IGL00784:Jhy APN 9 40922752 missense probably benign 0.00
IGL01370:Jhy APN 9 40917142 missense probably benign 0.00
IGL01433:Jhy APN 9 40917216 missense possibly damaging 0.58
IGL01618:Jhy APN 9 40960964 missense possibly damaging 0.88
IGL01981:Jhy APN 9 40895546 missense probably damaging 1.00
IGL02047:Jhy APN 9 40917180 missense probably benign 0.00
IGL02076:Jhy APN 9 40917378 nonsense probably null
IGL02093:Jhy APN 9 40944867 splice site probably null
IGL02177:Jhy APN 9 40898257 missense probably damaging 1.00
IGL02406:Jhy APN 9 40910989 missense probably damaging 1.00
IGL02548:Jhy APN 9 40917175 nonsense probably null
IGL02550:Jhy APN 9 40917170 missense probably benign 0.26
IGL02651:Jhy APN 9 40917335 missense probably damaging 1.00
IGL03080:Jhy APN 9 40944357 missense probably damaging 1.00
IGL03168:Jhy APN 9 40917552 missense possibly damaging 0.92
IGL03384:Jhy APN 9 40960932 missense probably benign 0.01
R0980:Jhy UTSW 9 40944837 missense possibly damaging 0.91
R1703:Jhy UTSW 9 40944837 missense probably damaging 1.00
R1711:Jhy UTSW 9 40911157 nonsense probably null
R1767:Jhy UTSW 9 40961148 missense probably benign 0.07
R2371:Jhy UTSW 9 40917482 missense probably benign 0.32
R3840:Jhy UTSW 9 40944846 missense probably benign 0.09
R3841:Jhy UTSW 9 40944846 missense probably benign 0.09
R4368:Jhy UTSW 9 40917144 missense possibly damaging 0.95
R4569:Jhy UTSW 9 40911093 missense probably benign
R4570:Jhy UTSW 9 40911093 missense probably benign
R4669:Jhy UTSW 9 40961153 missense probably benign 0.03
R4762:Jhy UTSW 9 40911198 missense probably benign
R4902:Jhy UTSW 9 40897525 intron probably benign
R4932:Jhy UTSW 9 40961003 missense possibly damaging 0.66
R5704:Jhy UTSW 9 40897438 missense probably damaging 0.99
R5890:Jhy UTSW 9 40922662 nonsense probably null
R6701:Jhy UTSW 9 40917591 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGTGTCTCCTGGTACTTAAGGC -3'
(R):5'- AGAGGCTAAGTCCTGGTCTG -3'

Sequencing Primer
(F):5'- ACTTAAGGCATGTTCTTGACGC -3'
(R):5'- AGTCCTGGTCTGATATTAAGGACC -3'
Posted On2014-11-12