Incidental Mutation 'R2432:Helb'
ID250457
Institutional Source Beutler Lab
Gene Symbol Helb
Ensembl Gene ENSMUSG00000020228
Gene Namehelicase (DNA) B
SynonymsD10Ertd664e
MMRRC Submission 040393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2432 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location120083608-120112987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120105537 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 415 (D415E)
Ref Sequence ENSEMBL: ENSMUSP00000116954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020449] [ENSMUST00000154501]
Predicted Effect probably benign
Transcript: ENSMUST00000020449
AA Change: D415E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020449
Gene: ENSMUSG00000020228
AA Change: D415E

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 661 4.8e-24 PFAM
Pfam:UvrD_C_2 855 901 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154501
AA Change: D415E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000116954
Gene: ENSMUSG00000020228
AA Change: D415E

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 546 1.2e-8 PFAM
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,451,333 probably benign Het
Adamts6 A T 13: 104,426,977 Y659F probably benign Het
Adamts9 C A 6: 92,857,900 G750W probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Aspscr1 A G 11: 120,702,566 probably benign Het
Calr3 A G 8: 72,438,426 probably benign Het
Cpt2 A T 4: 107,904,526 Y126* probably null Het
Cyp2d34 A G 15: 82,619,011 L94P probably damaging Het
Def6 A T 17: 28,228,069 D558V probably benign Het
Dnase1l2 G A 17: 24,442,725 T20I possibly damaging Het
Eif5b A G 1: 38,019,342 K242E unknown Het
Golim4 T C 3: 75,891,942 N478S possibly damaging Het
Ifna12 T A 4: 88,603,353 probably benign Het
Jhy T A 9: 40,960,886 H109L probably benign Het
Krt83 A T 15: 101,488,156 Y241* probably null Het
Macf1 G T 4: 123,683,996 A65E probably damaging Het
Mug2 C A 6: 122,084,376 N1418K possibly damaging Het
Myo1f A G 17: 33,575,849 D21G probably damaging Het
Myo5a T A 9: 75,212,873 I1651N possibly damaging Het
Notch3 A T 17: 32,153,804 C598S probably damaging Het
Npat A T 9: 53,558,135 H307L probably damaging Het
Nr1h2 T C 7: 44,551,367 Q279R possibly damaging Het
Olfr1302 T C 2: 111,780,671 V117A probably benign Het
Olfr804 A G 10: 129,704,925 T16A possibly damaging Het
Pcdhb16 A T 18: 37,479,930 N648Y probably damaging Het
Pdzrn3 G T 6: 101,150,791 S971R probably damaging Het
Plch2 A G 4: 154,986,164 *494Q probably null Het
Plekhg4 T A 8: 105,381,836 D1170E probably benign Het
Plekhm3 A G 1: 64,937,856 S152P probably damaging Het
Ppargc1b G A 18: 61,307,799 P683S possibly damaging Het
Prdm12 T G 2: 31,651,852 M191R probably benign Het
Prdm14 T C 1: 13,125,633 D68G probably benign Het
Prp2 C T 6: 132,599,911 P54S unknown Het
Prpf4b A G 13: 34,883,341 probably benign Het
Ptprk T A 10: 28,592,844 V1408E probably damaging Het
Rap1gds1 A G 3: 138,956,250 M415T probably damaging Het
Rps6ka5 A G 12: 100,554,405 F621S probably damaging Het
Rrm1 T A 7: 102,443,072 D35E probably benign Het
Rxfp3 T C 15: 11,036,140 H382R probably damaging Het
Slc11a1 A G 1: 74,383,751 probably benign Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc30a3 T C 5: 31,088,694 S231G probably damaging Het
Slc44a2 A T 9: 21,344,834 I274F probably damaging Het
Tas2r119 A G 15: 32,178,019 I244V possibly damaging Het
Tenm2 C A 11: 36,027,191 R1914L probably damaging Het
Tfdp2 T C 9: 96,310,590 M242T probably damaging Het
Tmprss6 A G 15: 78,465,104 probably benign Het
Ttc6 C T 12: 57,622,035 P421L possibly damaging Het
Usp16 T A 16: 87,466,358 probably null Het
Usp40 T C 1: 87,982,082 E550G probably benign Het
Vmn2r28 T C 7: 5,488,702 Y182C probably damaging Het
Zfp382 A G 7: 30,133,749 D275G probably benign Het
Other mutations in Helb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Helb APN 10 120098245 missense possibly damaging 0.88
IGL00516:Helb APN 10 120105424 missense probably damaging 1.00
IGL00924:Helb APN 10 120110984 missense probably benign 0.01
IGL00971:Helb APN 10 120094263 missense possibly damaging 0.50
IGL01142:Helb APN 10 120111144 missense probably damaging 1.00
IGL01483:Helb APN 10 120111138 missense probably damaging 1.00
IGL01688:Helb APN 10 120108980 missense probably damaging 0.99
IGL01860:Helb APN 10 120102833 missense probably damaging 0.97
IGL02298:Helb APN 10 120101526 missense probably damaging 1.00
IGL02501:Helb APN 10 120102788 missense possibly damaging 0.96
IGL02554:Helb APN 10 120089712 missense probably damaging 1.00
IGL02810:Helb APN 10 120091703 missense possibly damaging 0.48
IGL02902:Helb APN 10 120089485 missense probably benign 0.00
IGL03405:Helb APN 10 120089796 missense probably damaging 1.00
R0004:Helb UTSW 10 120108981 missense probably damaging 1.00
R0092:Helb UTSW 10 120089808 missense probably damaging 1.00
R0436:Helb UTSW 10 120094212 splice site probably benign
R0850:Helb UTSW 10 120105367 missense probably damaging 1.00
R1423:Helb UTSW 10 120108966 missense probably damaging 0.99
R1663:Helb UTSW 10 120105433 missense probably damaging 1.00
R1756:Helb UTSW 10 120094242 missense probably damaging 0.96
R1812:Helb UTSW 10 120089566 nonsense probably null
R1976:Helb UTSW 10 120094263 missense possibly damaging 0.50
R2049:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2063:Helb UTSW 10 120105766 missense probably benign
R2141:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2180:Helb UTSW 10 120105448 missense probably benign 0.02
R3030:Helb UTSW 10 120089582 nonsense probably null
R3874:Helb UTSW 10 120106037 missense probably benign 0.31
R3978:Helb UTSW 10 120089625 missense probably benign
R4731:Helb UTSW 10 120094288 critical splice acceptor site probably null
R4734:Helb UTSW 10 120084849 missense probably benign
R4748:Helb UTSW 10 120084849 missense probably benign
R4749:Helb UTSW 10 120084849 missense probably benign
R4840:Helb UTSW 10 120084858 missense probably benign 0.33
R4977:Helb UTSW 10 120110881 missense probably benign 0.01
R5149:Helb UTSW 10 120105743 missense probably benign 0.39
R5220:Helb UTSW 10 120101486 missense probably damaging 1.00
R5447:Helb UTSW 10 120102901 missense possibly damaging 0.88
R5637:Helb UTSW 10 120105448 missense probably benign 0.02
R5660:Helb UTSW 10 120111079 nonsense probably null
R5663:Helb UTSW 10 120105793 missense possibly damaging 0.61
R5806:Helb UTSW 10 120092519 missense probably damaging 1.00
R5951:Helb UTSW 10 120091748 missense possibly damaging 0.91
R6010:Helb UTSW 10 120105883 missense probably damaging 1.00
R6183:Helb UTSW 10 120112998 unclassified probably null
R6578:Helb UTSW 10 120111181 missense probably damaging 1.00
R6642:Helb UTSW 10 120084930 missense probably benign 0.17
R6666:Helb UTSW 10 120084951 missense probably damaging 0.99
R6705:Helb UTSW 10 120089811 unclassified probably null
R6746:Helb UTSW 10 120105468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAAATCCTCGCAGGCTTG -3'
(R):5'- AAGACATCGCCTCCTCCATCTG -3'

Sequencing Primer
(F):5'- GATGTTCCATGTGCTTAAAAAGACGG -3'
(R):5'- ATCTGCGAGCTGATGAGC -3'
Posted On2014-11-12