Incidental Mutation 'R2432:Olfr804'
ID250458
Institutional Source Beutler Lab
Gene Symbol Olfr804
Ensembl Gene ENSMUSG00000095401
Gene Nameolfactory receptor 804
SynonymsMOR110-7, GA_x6K02T2PULF-11383575-11384519
MMRRC Submission 040393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2432 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129703210-129710018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129704925 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 16 (T16A)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077312
AA Change: T16A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: T16A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213331
AA Change: T16A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216747
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,451,333 probably benign Het
Adamts6 A T 13: 104,426,977 Y659F probably benign Het
Adamts9 C A 6: 92,857,900 G750W probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Aspscr1 A G 11: 120,702,566 probably benign Het
Calr3 A G 8: 72,438,426 probably benign Het
Cpt2 A T 4: 107,904,526 Y126* probably null Het
Cyp2d34 A G 15: 82,619,011 L94P probably damaging Het
Def6 A T 17: 28,228,069 D558V probably benign Het
Dnase1l2 G A 17: 24,442,725 T20I possibly damaging Het
Eif5b A G 1: 38,019,342 K242E unknown Het
Golim4 T C 3: 75,891,942 N478S possibly damaging Het
Helb A T 10: 120,105,537 D415E probably benign Het
Ifna12 T A 4: 88,603,353 probably benign Het
Jhy T A 9: 40,960,886 H109L probably benign Het
Krt83 A T 15: 101,488,156 Y241* probably null Het
Macf1 G T 4: 123,683,996 A65E probably damaging Het
Mug2 C A 6: 122,084,376 N1418K possibly damaging Het
Myo1f A G 17: 33,575,849 D21G probably damaging Het
Myo5a T A 9: 75,212,873 I1651N possibly damaging Het
Notch3 A T 17: 32,153,804 C598S probably damaging Het
Npat A T 9: 53,558,135 H307L probably damaging Het
Nr1h2 T C 7: 44,551,367 Q279R possibly damaging Het
Olfr1302 T C 2: 111,780,671 V117A probably benign Het
Pcdhb16 A T 18: 37,479,930 N648Y probably damaging Het
Pdzrn3 G T 6: 101,150,791 S971R probably damaging Het
Plch2 A G 4: 154,986,164 *494Q probably null Het
Plekhg4 T A 8: 105,381,836 D1170E probably benign Het
Plekhm3 A G 1: 64,937,856 S152P probably damaging Het
Ppargc1b G A 18: 61,307,799 P683S possibly damaging Het
Prdm12 T G 2: 31,651,852 M191R probably benign Het
Prdm14 T C 1: 13,125,633 D68G probably benign Het
Prp2 C T 6: 132,599,911 P54S unknown Het
Prpf4b A G 13: 34,883,341 probably benign Het
Ptprk T A 10: 28,592,844 V1408E probably damaging Het
Rap1gds1 A G 3: 138,956,250 M415T probably damaging Het
Rps6ka5 A G 12: 100,554,405 F621S probably damaging Het
Rrm1 T A 7: 102,443,072 D35E probably benign Het
Rxfp3 T C 15: 11,036,140 H382R probably damaging Het
Slc11a1 A G 1: 74,383,751 probably benign Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc30a3 T C 5: 31,088,694 S231G probably damaging Het
Slc44a2 A T 9: 21,344,834 I274F probably damaging Het
Tas2r119 A G 15: 32,178,019 I244V possibly damaging Het
Tenm2 C A 11: 36,027,191 R1914L probably damaging Het
Tfdp2 T C 9: 96,310,590 M242T probably damaging Het
Tmprss6 A G 15: 78,465,104 probably benign Het
Ttc6 C T 12: 57,622,035 P421L possibly damaging Het
Usp16 T A 16: 87,466,358 probably null Het
Usp40 T C 1: 87,982,082 E550G probably benign Het
Vmn2r28 T C 7: 5,488,702 Y182C probably damaging Het
Zfp382 A G 7: 30,133,749 D275G probably benign Het
Other mutations in Olfr804
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr804 APN 10 129705623 missense probably benign 0.01
IGL02041:Olfr804 APN 10 129705235 missense probably damaging 1.00
IGL02245:Olfr804 APN 10 129705739 missense probably damaging 1.00
IGL02341:Olfr804 APN 10 129705489 missense probably damaging 0.99
IGL02433:Olfr804 APN 10 129705576 missense probably benign 0.01
authen UTSW 10 129705799 missense probably benign 0.00
R0111:Olfr804 UTSW 10 129705277 missense probably damaging 1.00
R0309:Olfr804 UTSW 10 129705139 missense probably benign 0.38
R0326:Olfr804 UTSW 10 129705769 missense possibly damaging 0.69
R0374:Olfr804 UTSW 10 129705647 missense probably benign 0.00
R1573:Olfr804 UTSW 10 129705618 missense probably damaging 1.00
R1663:Olfr804 UTSW 10 129705291 missense probably benign 0.44
R1778:Olfr804 UTSW 10 129705705 missense probably benign 0.01
R1789:Olfr804 UTSW 10 129705607 missense possibly damaging 0.82
R1906:Olfr804 UTSW 10 129705496 missense probably benign 0.00
R2108:Olfr804 UTSW 10 129705621 missense probably benign
R2211:Olfr804 UTSW 10 129705451 missense probably benign
R2902:Olfr804 UTSW 10 129705451 missense probably benign
R4114:Olfr804 UTSW 10 129705799 missense probably benign 0.00
R5149:Olfr804 UTSW 10 129705508 missense probably benign 0.00
R5153:Olfr804 UTSW 10 129705157 missense probably benign 0.05
R5846:Olfr804 UTSW 10 129704887 missense probably damaging 0.99
R6553:Olfr804 UTSW 10 129705063 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GAAATTTCAGGCTAGAGAACACTTG -3'
(R):5'- CAGTCACAATGGCTGTCAAG -3'

Sequencing Primer
(F):5'- TTCAGGCTAGAGAACACTTGAAAATG -3'
(R):5'- GTCACAATGGCTGTCAAGAATTTGG -3'
Posted On2014-11-12