Mutagenetix > Incidental Mutation

Incidental Mutation 'R2433:Pttg1'

250496

Institutional Source

Beutler Lab

Gene Symbol

Pttg1

Ensembl Gene

ENSMUSG00000020415

Gene Name

pituitary tumor-transforming gene 1

Synonyms

PTTG, securin

MMRRC Submission

040394-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2433 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43311077-43317078 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43311178 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 193 (V193D)

Ref Sequence

ENSEMBL: ENSMUSP00000112815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020685] [ENSMUST00000020687] [ENSMUST00000101340] [ENSMUST00000117446] [ENSMUST00000118368] [ENSMUST00000121638] [ENSMUST00000140434] [ENSMUST00000152115]

AlphaFold

Q9CQJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000020685

SMART Domains

Protein: ENSMUSP00000020685
Gene: ENSMUSG00000020415

Domain	Start	End	E-Value	Type
Pfam:Securin	1	186	1.4e-41	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000020687
AA Change: V193D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020687
Gene: ENSMUSG00000020415
AA Change: V193D

Domain	Start	End	E-Value	Type
Pfam:Securin	1	184	1.9e-40	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000101340
AA Change: V193D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098894
Gene: ENSMUSG00000020415
AA Change: V193D

Domain	Start	End	E-Value	Type
Pfam:Securin	1	181	3.1e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117446

SMART Domains

Protein: ENSMUSP00000112841
Gene: ENSMUSG00000020415

Domain	Start	End	E-Value	Type
Pfam:Securin	1	186	1.4e-41	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118368
AA Change: V193D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112834
Gene: ENSMUSG00000020415
AA Change: V193D

Domain	Start	End	E-Value	Type
Pfam:Securin	1	181	3.1e-41	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121638
AA Change: V193D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112815
Gene: ENSMUSG00000020415
AA Change: V193D

Domain	Start	End	E-Value	Type
Pfam:Securin	1	181	3.1e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140434

SMART Domains

Protein: ENSMUSP00000122019
Gene: ENSMUSG00000020415

Domain	Start	End	E-Value	Type
Pfam:Securin	1	97	1.6e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148130

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150726

Predicted Effect

probably benign
Transcript: ENSMUST00000152115

SMART Domains

Protein: ENSMUSP00000119554
Gene: ENSMUSG00000020415

Domain	Start	End	E-Value	Type
Pfam:Securin	1	122	1.7e-25	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show testicular and splenic hypoplasia, thymic hyperplasia, thrombocytopenia, aberrant cell cycle progression, chromosome instability, premature centromere division, reduced female fertility, reduced pancreatic betacell mass and sexually-dimorphic diabetes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6v0a4	A	G	6: 38,058,964 (GRCm39)		probably null	Het
Bpifb4	A	G	2: 153,801,597 (GRCm39)	K573E	probably damaging	Het
Capn10	T	A	1: 92,870,247 (GRCm39)	D244E	probably benign	Het
Dhrs11	C	A	11: 84,719,745 (GRCm39)		probably benign	Het
Eipr1	G	A	12: 28,913,042 (GRCm39)	G248R	probably damaging	Het
Fam120a	A	C	13: 49,087,444 (GRCm39)	D305E	probably damaging	Het
Hmgcr	A	G	13: 96,802,393 (GRCm39)	L97P	probably damaging	Het
Htt	A	T	5: 35,064,885 (GRCm39)	S3033C	possibly damaging	Het
Igkv10-94	T	C	6: 68,681,559 (GRCm39)	T94A	probably benign	Het
Krtap16-3	T	C	16: 88,759,533 (GRCm39)	Y60C	unknown	Het
Lrp4	G	A	2: 91,336,360 (GRCm39)	V1724I	probably benign	Het
Myo5b	A	G	18: 74,892,158 (GRCm39)	Y1634C	probably damaging	Het
Nrxn3	A	G	12: 89,943,160 (GRCm39)	Y96C	probably damaging	Het
Obscn	A	T	11: 58,929,912 (GRCm39)		probably null	Het
Pde3b	T	C	7: 114,126,072 (GRCm39)	C769R	probably benign	Het
Phlpp2	T	G	8: 110,666,634 (GRCm39)	C1054W	probably damaging	Het
Robo1	T	C	16: 72,767,127 (GRCm39)	L433S	probably benign	Het
Sema4f	A	T	6: 82,916,490 (GRCm39)	C13S	possibly damaging	Het
Slc12a3	T	C	8: 95,072,944 (GRCm39)	L689P	probably benign	Het
Slc7a6os	T	C	8: 106,931,003 (GRCm39)	N211S	possibly damaging	Het
Smurf2	T	A	11: 106,759,490 (GRCm39)	I69F	probably benign	Het
St8sia3	A	T	18: 64,402,787 (GRCm39)	H198L	probably benign	Het
Tacc3	A	G	5: 33,829,083 (GRCm39)	K594R	possibly damaging	Het
Trip12	A	T	1: 84,721,544 (GRCm39)	I1396K	possibly damaging	Het
Ugcg	A	G	4: 59,207,876 (GRCm39)	T72A	possibly damaging	Het
Zfp944	A	T	17: 22,558,193 (GRCm39)	Y351*	probably null	Het

Other mutations in Pttg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1826:Pttg1	UTSW	11	43,311,193 (GRCm39)	missense	probably damaging	0.98
R4448:Pttg1	UTSW	11	43,315,517 (GRCm39)	intron	probably benign
R4663:Pttg1	UTSW	11	43,315,677 (GRCm39)	nonsense	probably null
R6483:Pttg1	UTSW	11	43,315,671 (GRCm39)	missense	probably damaging	0.98
R7104:Pttg1	UTSW	11	43,311,976 (GRCm39)	missense	probably benign	0.12
R7289:Pttg1	UTSW	11	43,311,916 (GRCm39)	missense	probably benign	0.01
R7914:Pttg1	UTSW	11	43,316,421 (GRCm39)	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- GACACATTGAGGGGTCTACTTC -3'
(R):5'- TGACTACCCACACTGATGCC -3'

Sequencing Primer
(F):5'- CACATTGAGGGGTCTACTTCCAAAG -3'
(R):5'- GATGCCGACACTGATGCTACATG -3'

Posted On

2014-11-12