Incidental Mutation 'R2433:Smurf2'
ID250499
Institutional Source Beutler Lab
Gene Symbol Smurf2
Ensembl Gene ENSMUSG00000018363
Gene NameSMAD specific E3 ubiquitin protein ligase 2
Synonyms2810411E22Rik
MMRRC Submission 040394-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2433 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106820066-106920715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106868664 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 69 (I69F)
Ref Sequence ENSEMBL: ENSMUSP00000129269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092517] [ENSMUST00000103067] [ENSMUST00000139297] [ENSMUST00000167787]
Predicted Effect probably benign
Transcript: ENSMUST00000092517
AA Change: I69F

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090177
Gene: ENSMUSG00000018363
AA Change: I69F

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103067
AA Change: I56F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099356
Gene: ENSMUSG00000018363
AA Change: I56F

DomainStartEndE-ValueType
C2 13 103 1e-6 SMART
WW 145 177 1.96e-11 SMART
WW 239 271 2.47e-8 SMART
WW 285 317 4.97e-13 SMART
low complexity region 328 338 N/A INTRINSIC
HECTc 399 735 1.75e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139297
Predicted Effect probably benign
Transcript: ENSMUST00000167787
AA Change: I69F

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129269
Gene: ENSMUSG00000018363
AA Change: I69F

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele occasionally exhibit kinked or looped tails and abnormal vertebrae. Mice homozygous or heterozygous for a gene trap allele exhibit increased tumor incidence and delayed cellular senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0a4 A G 6: 38,082,029 probably null Het
Bpifb4 A G 2: 153,959,677 K573E probably damaging Het
Capn10 T A 1: 92,942,525 D244E probably benign Het
Dhrs11 C A 11: 84,828,919 probably benign Het
Eipr1 G A 12: 28,863,043 G248R probably damaging Het
Fam120a A C 13: 48,933,968 D305E probably damaging Het
Hmgcr A G 13: 96,665,885 L97P probably damaging Het
Htt A T 5: 34,907,541 S3033C possibly damaging Het
Igkv10-94 T C 6: 68,704,575 T94A probably benign Het
Krtap16-3 T C 16: 88,962,645 Y60C unknown Het
Lrp4 G A 2: 91,506,015 V1724I probably benign Het
Myo5b A G 18: 74,759,087 Y1634C probably damaging Het
Nrxn3 A G 12: 89,976,392 Y96C probably damaging Het
Obscn A T 11: 59,039,086 probably null Het
Pde3b T C 7: 114,526,837 C769R probably benign Het
Phlpp2 T G 8: 109,940,002 C1054W probably damaging Het
Pttg1 A T 11: 43,420,351 V193D probably damaging Het
Robo1 T C 16: 72,970,239 L433S probably benign Het
Sema4f A T 6: 82,939,509 C13S possibly damaging Het
Slc12a3 T C 8: 94,346,316 L689P probably benign Het
Slc7a6os T C 8: 106,204,371 N211S possibly damaging Het
St8sia3 A T 18: 64,269,716 H198L probably benign Het
Tacc3 A G 5: 33,671,739 K594R possibly damaging Het
Trip12 A T 1: 84,743,823 I1396K possibly damaging Het
Ugcg A G 4: 59,207,876 T72A possibly damaging Het
Zfp944 A T 17: 22,339,212 Y351* probably null Het
Other mutations in Smurf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Smurf2 APN 11 106852636 missense probably benign 0.17
IGL00980:Smurf2 APN 11 106836095 missense probably damaging 1.00
IGL01346:Smurf2 APN 11 106830915 splice site probably benign
IGL02016:Smurf2 APN 11 106822678 missense probably damaging 1.00
IGL02937:Smurf2 APN 11 106846047 missense probably damaging 1.00
IGL03136:Smurf2 APN 11 106831048 missense probably benign 0.38
R0513:Smurf2 UTSW 11 106836105 missense probably benign 0.22
R1171:Smurf2 UTSW 11 106852618 missense possibly damaging 0.80
R1459:Smurf2 UTSW 11 106852507 missense possibly damaging 0.78
R1687:Smurf2 UTSW 11 106836070 splice site probably null
R1697:Smurf2 UTSW 11 106824688 missense possibly damaging 0.76
R1706:Smurf2 UTSW 11 106824747 missense probably damaging 1.00
R2064:Smurf2 UTSW 11 106871548 missense probably damaging 1.00
R2072:Smurf2 UTSW 11 106841769 missense probably benign 0.00
R5250:Smurf2 UTSW 11 106856179 critical splice donor site probably null
R5531:Smurf2 UTSW 11 106852563 missense possibly damaging 0.47
R5835:Smurf2 UTSW 11 106836148 missense probably damaging 1.00
R5966:Smurf2 UTSW 11 106875901 missense possibly damaging 0.78
R6093:Smurf2 UTSW 11 106868623 missense possibly damaging 0.75
R6230:Smurf2 UTSW 11 106868504 intron probably null
R6373:Smurf2 UTSW 11 106833769 missense probably damaging 1.00
R7011:Smurf2 UTSW 11 106833784 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGGAACTTAAGTTTTGGACACC -3'
(R):5'- AAGTCTCTGAATGACATTCCCAAAC -3'

Sequencing Primer
(F):5'- GAACTTAAGTTTTGGACACCTACTAC -3'
(R):5'- TCCCAAACCCTAAAATAGCTTTTTCG -3'
Posted On2014-11-12