Incidental Mutation 'R2433:Eipr1'
ID250500
Institutional Source Beutler Lab
Gene Symbol Eipr1
Ensembl Gene ENSMUSG00000036613
Gene NameEARP complex and GARP complex interacting protein 1
SynonymsTssc1, D12Ertd604e
MMRRC Submission 040394-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R2433 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location28751803-28869865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28863043 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 248 (G248R)
Ref Sequence ENSEMBL: ENSMUSP00000152220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035657] [ENSMUST00000221555] [ENSMUST00000221877]
Predicted Effect probably benign
Transcript: ENSMUST00000035657
SMART Domains Protein: ENSMUSP00000038845
Gene: ENSMUSG00000036613

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
Blast:WD40 57 100 1e-18 BLAST
WD40 122 163 6.39e0 SMART
WD40 172 213 2.29e1 SMART
WD40 216 257 6.38e-7 SMART
WD40 261 301 4.38e-5 SMART
WD40 335 375 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220933
Predicted Effect probably damaging
Transcript: ENSMUST00000221555
AA Change: G150R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221574
Predicted Effect probably damaging
Transcript: ENSMUST00000221877
AA Change: G248R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been reported in PMID 9403053 as one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. Alignment of this gene to genomic sequence data suggests that this gene resides on chromosome 2 rather than chromosome 11. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0a4 A G 6: 38,082,029 probably null Het
Bpifb4 A G 2: 153,959,677 K573E probably damaging Het
Capn10 T A 1: 92,942,525 D244E probably benign Het
Dhrs11 C A 11: 84,828,919 probably benign Het
Fam120a A C 13: 48,933,968 D305E probably damaging Het
Hmgcr A G 13: 96,665,885 L97P probably damaging Het
Htt A T 5: 34,907,541 S3033C possibly damaging Het
Igkv10-94 T C 6: 68,704,575 T94A probably benign Het
Krtap16-3 T C 16: 88,962,645 Y60C unknown Het
Lrp4 G A 2: 91,506,015 V1724I probably benign Het
Myo5b A G 18: 74,759,087 Y1634C probably damaging Het
Nrxn3 A G 12: 89,976,392 Y96C probably damaging Het
Obscn A T 11: 59,039,086 probably null Het
Pde3b T C 7: 114,526,837 C769R probably benign Het
Phlpp2 T G 8: 109,940,002 C1054W probably damaging Het
Pttg1 A T 11: 43,420,351 V193D probably damaging Het
Robo1 T C 16: 72,970,239 L433S probably benign Het
Sema4f A T 6: 82,939,509 C13S possibly damaging Het
Slc12a3 T C 8: 94,346,316 L689P probably benign Het
Slc7a6os T C 8: 106,204,371 N211S possibly damaging Het
Smurf2 T A 11: 106,868,664 I69F probably benign Het
St8sia3 A T 18: 64,269,716 H198L probably benign Het
Tacc3 A G 5: 33,671,739 K594R possibly damaging Het
Trip12 A T 1: 84,743,823 I1396K possibly damaging Het
Ugcg A G 4: 59,207,876 T72A possibly damaging Het
Zfp944 A T 17: 22,339,212 Y351* probably null Het
Other mutations in Eipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Eipr1 APN 12 28864771 missense probably damaging 1.00
hoss UTSW 12 28864762 missense probably damaging 1.00
R0331:Eipr1 UTSW 12 28864704 nonsense probably null
R0352:Eipr1 UTSW 12 28766785 missense probably damaging 0.98
R0433:Eipr1 UTSW 12 28859331 missense possibly damaging 0.68
R1807:Eipr1 UTSW 12 28766839 missense probably damaging 1.00
R1883:Eipr1 UTSW 12 28766851 missense possibly damaging 0.82
R1926:Eipr1 UTSW 12 28864837 splice site probably null
R1981:Eipr1 UTSW 12 28863025 missense probably damaging 1.00
R2877:Eipr1 UTSW 12 28760092 missense possibly damaging 0.70
R2970:Eipr1 UTSW 12 28847594 missense probably benign 0.00
R2990:Eipr1 UTSW 12 28859268 missense probably benign 0.06
R4412:Eipr1 UTSW 12 28859373 missense probably damaging 1.00
R4463:Eipr1 UTSW 12 28859339 missense probably damaging 1.00
R5087:Eipr1 UTSW 12 28828856 missense probably benign 0.11
R5430:Eipr1 UTSW 12 28863016 missense probably damaging 1.00
R5619:Eipr1 UTSW 12 28867079 missense probably damaging 1.00
R6454:Eipr1 UTSW 12 28864762 missense probably damaging 1.00
R6696:Eipr1 UTSW 12 28859358 missense probably benign
R7038:Eipr1 UTSW 12 28751818 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCCAGCTCTTTCTTCAG -3'
(R):5'- GGGCTGATTGAATGATTCACAG -3'

Sequencing Primer
(F):5'- AGCTCTTTCTTCAGCTGGG -3'
(R):5'- CTGATTGAATGATTCACAGCAGCAC -3'
Posted On2014-11-12