Incidental Mutation 'R2433:Nrxn3'
ID250502
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Nameneurexin III
Synonyms4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta
MMRRC Submission 040394-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2433 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location88722876-90334935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89976392 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 96 (Y96C)
Ref Sequence ENSEMBL: ENSMUSP00000105760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000110130] [ENSMUST00000110133] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]
Predicted Effect probably damaging
Transcript: ENSMUST00000057634
AA Change: Y739C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392
AA Change: Y739C

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110130
AA Change: Y96C

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105757
Gene: ENSMUSG00000066392
AA Change: Y96C

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamG 107 264 1.14e-17 SMART
Blast:LamG 294 410 6e-47 BLAST
low complexity region 492 507 N/A INTRINSIC
4.1m 510 528 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110133
AA Change: Y96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105760
Gene: ENSMUSG00000066392
AA Change: Y96C

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamG 107 234 1.8e-20 SMART
Blast:LamG 264 330 1e-19 BLAST
low complexity region 358 373 N/A INTRINSIC
4.1m 376 394 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163134
AA Change: Y1103C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: Y1103C

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167103
AA Change: Y1094C

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392
AA Change: Y1094C

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167887
AA Change: Y739C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392
AA Change: Y739C

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190626
AA Change: Y739C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392
AA Change: Y739C

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0a4 A G 6: 38,082,029 probably null Het
Bpifb4 A G 2: 153,959,677 K573E probably damaging Het
Capn10 T A 1: 92,942,525 D244E probably benign Het
Dhrs11 C A 11: 84,828,919 probably benign Het
Eipr1 G A 12: 28,863,043 G248R probably damaging Het
Fam120a A C 13: 48,933,968 D305E probably damaging Het
Hmgcr A G 13: 96,665,885 L97P probably damaging Het
Htt A T 5: 34,907,541 S3033C possibly damaging Het
Igkv10-94 T C 6: 68,704,575 T94A probably benign Het
Krtap16-3 T C 16: 88,962,645 Y60C unknown Het
Lrp4 G A 2: 91,506,015 V1724I probably benign Het
Myo5b A G 18: 74,759,087 Y1634C probably damaging Het
Obscn A T 11: 59,039,086 probably null Het
Pde3b T C 7: 114,526,837 C769R probably benign Het
Phlpp2 T G 8: 109,940,002 C1054W probably damaging Het
Pttg1 A T 11: 43,420,351 V193D probably damaging Het
Robo1 T C 16: 72,970,239 L433S probably benign Het
Sema4f A T 6: 82,939,509 C13S possibly damaging Het
Slc12a3 T C 8: 94,346,316 L689P probably benign Het
Slc7a6os T C 8: 106,204,371 N211S possibly damaging Het
Smurf2 T A 11: 106,868,664 I69F probably benign Het
St8sia3 A T 18: 64,269,716 H198L probably benign Het
Tacc3 A G 5: 33,671,739 K594R possibly damaging Het
Trip12 A T 1: 84,743,823 I1396K possibly damaging Het
Ugcg A G 4: 59,207,876 T72A possibly damaging Het
Zfp944 A T 17: 22,339,212 Y351* probably null Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90204592 missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90204546 missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89254740 missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89255034 missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89533012 critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89510358 missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90204750 missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88795795 missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89193163 missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89976407 missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90204628 missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88795353 missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89511912 splice site probably benign
IGL02735:Nrxn3 APN 12 89254854 missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89511928 nonsense probably null
IGL03206:Nrxn3 APN 12 89260508 missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89255020 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89348392 missense probably damaging 1.00
R0334:Nrxn3 UTSW 12 89813642 critical splice donor site probably null
R0531:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90331793 missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89254696 missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90332135 missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89254777 missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88795710 missense probably benign
R1637:Nrxn3 UTSW 12 89354468 missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90332391 missense probably damaging 1.00
R1746:Nrxn3 UTSW 12 89255019 missense possibly damaging 0.63
R1801:Nrxn3 UTSW 12 90283582 missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89260381 missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89260411 missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90332315 missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89260520 splice site probably null
R2179:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89348312 missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89510365 missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89354471 missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89255101 missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89533001 missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89532992 nonsense probably null
R4321:Nrxn3 UTSW 12 90199231 missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89510651 missense probably damaging 0.99
R4776:Nrxn3 UTSW 12 90331956 missense possibly damaging 0.55
R4821:Nrxn3 UTSW 12 90204709 missense probably damaging 0.99
R4869:Nrxn3 UTSW 12 88795582 missense possibly damaging 0.95
R4910:Nrxn3 UTSW 12 89260360 missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88795201 missense possibly damaging 0.79
R4990:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R4991:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R5057:Nrxn3 UTSW 12 89255034 missense probably damaging 0.99
R5329:Nrxn3 UTSW 12 89813584 missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89512085 missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90332237 missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89976469 missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89255000 missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88795515 missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89513049 missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89813332 intron probably benign
R6632:Nrxn3 UTSW 12 89193154 missense probably damaging 1.00
R6874:Nrxn3 UTSW 12 90332190 missense probably damaging 0.99
R7122:Nrxn3 UTSW 12 89510607 missense not run
X0019:Nrxn3 UTSW 12 90199221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACCTGAGGCTTTGGAAATC -3'
(R):5'- TATCTAATGCACACCAGGAAGG -3'

Sequencing Primer
(F):5'- ACCTGAGGCTTTGGAAATCATCTC -3'
(R):5'- GTAAGAGAATCCAAGCCAAGACTG -3'
Posted On2014-11-12