Incidental Mutation 'R2446:2210010C04Rik'
ID250567
Institutional Source Beutler Lab
Gene Symbol 2210010C04Rik
Ensembl Gene ENSMUSG00000029882
Gene NameRIKEN cDNA 2210010C04 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2446 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41030268-41035509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41031648 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 244 (I244T)
Ref Sequence ENSEMBL: ENSMUSP00000031931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031931]
Predicted Effect probably benign
Transcript: ENSMUST00000031931
AA Change: I244T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031931
Gene: ENSMUSG00000029882
AA Change: I244T

DomainStartEndE-ValueType
Tryp_SPc 24 240 3.52e-102 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,275,101 R527G probably benign Het
Cap1 T A 4: 122,864,608 I260F probably benign Het
Chst9 T C 18: 15,452,838 K223E possibly damaging Het
Dpy19l4 A T 4: 11,304,143 probably null Het
Ercc2 T C 7: 19,386,944 I223T probably damaging Het
Hydin T C 8: 110,587,715 L4277P possibly damaging Het
Ibtk T C 9: 85,703,073 N1173D probably benign Het
Klra17 T A 6: 129,831,514 H252L probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Npc1 A G 18: 12,214,339 V208A probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1461 T G 19: 13,165,447 C144W probably benign Het
P2rx7 A T 5: 122,680,816 M434L probably benign Het
Pcdhb9 G A 18: 37,403,287 G778E probably damaging Het
Scn7a A G 2: 66,692,658 Y901H probably damaging Het
Tlcd1 G A 11: 78,178,797 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r3 A G 3: 64,275,312 I322T probably damaging Het
Zbtb38 C T 9: 96,687,646 V462M probably damaging Het
Other mutations in 2210010C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:2210010C04Rik APN 6 41031673 missense probably damaging 1.00
IGL01625:2210010C04Rik APN 6 41032948 missense probably benign 0.01
IGL02159:2210010C04Rik APN 6 41032957 missense probably benign 0.34
IGL03161:2210010C04Rik APN 6 41034306 missense probably damaging 0.96
R0419:2210010C04Rik UTSW 6 41034347 missense probably benign 0.05
R1715:2210010C04Rik UTSW 6 41032936 splice site probably null
R2057:2210010C04Rik UTSW 6 41032381 missense probably benign 0.06
R2059:2210010C04Rik UTSW 6 41032381 missense probably benign 0.06
R2136:2210010C04Rik UTSW 6 41035462 missense probably benign 0.28
R4862:2210010C04Rik UTSW 6 41032411 missense possibly damaging 0.74
R5068:2210010C04Rik UTSW 6 41032436 missense probably benign 0.35
R5369:2210010C04Rik UTSW 6 41033006 missense probably benign 0.00
R6392:2210010C04Rik UTSW 6 41032372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTAAGGTGTGCCAGC -3'
(R):5'- AGTGGCCCGAGATAATCAAG -3'

Sequencing Primer
(F):5'- AGGTGTGCCAGCTATATTAATAAAC -3'
(R):5'- GCCCGAGATAATCAAGTAACAACTTG -3'
Posted On2014-11-12