Incidental Mutation 'R2446:Lmf1'
ID 250578
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Name lipase maturation factor 1
Synonyms Tmem112, 2400010G15Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2446 (G1)
Quality Score 212
Status Not validated
Chromosome 17
Chromosomal Location 25798059-25881800 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25873445 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 317 (V317M)
Ref Sequence ENSEMBL: ENSMUSP00000112340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
AlphaFold Q3U3R4
Predicted Effect probably damaging
Transcript: ENSMUST00000063344
AA Change: V317M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: V317M

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116641
AA Change: V317M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: V317M

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137201
Predicted Effect probably benign
Transcript: ENSMUST00000141606
SMART Domains Protein: ENSMUSP00000129263
Gene: ENSMUSG00000002279

DomainStartEndE-ValueType
Pfam:LMF1 2 90 9.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154842
SMART Domains Protein: ENSMUSP00000119563
Gene: ENSMUSG00000002279

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:LMF1 166 298 2.4e-60 PFAM
Meta Mutation Damage Score 0.8099 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,225,101 (GRCm39) R527G probably benign Het
Cap1 T A 4: 122,758,401 (GRCm39) I260F probably benign Het
Chst9 T C 18: 15,585,895 (GRCm39) K223E possibly damaging Het
Dpy19l4 A T 4: 11,304,143 (GRCm39) probably null Het
Ercc2 T C 7: 19,120,869 (GRCm39) I223T probably damaging Het
Hydin T C 8: 111,314,347 (GRCm39) L4277P possibly damaging Het
Ibtk T C 9: 85,585,126 (GRCm39) N1173D probably benign Het
Klra17 T A 6: 129,808,477 (GRCm39) H252L probably benign Het
Ltbp3 G A 19: 5,804,050 (GRCm39) R854Q probably benign Het
Npc1 A G 18: 12,347,396 (GRCm39) V208A probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or5b107 T G 19: 13,142,811 (GRCm39) C144W probably benign Het
P2rx7 A T 5: 122,818,879 (GRCm39) M434L probably benign Het
Pcdhb9 G A 18: 37,536,340 (GRCm39) G778E probably damaging Het
Prss3b A G 6: 41,008,582 (GRCm39) I244T probably benign Het
Scn7a A G 2: 66,523,002 (GRCm39) Y901H probably damaging Het
Tlcd1 G A 11: 78,069,623 (GRCm39) probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Vmn2r3 A G 3: 64,182,733 (GRCm39) I322T probably damaging Het
Zbtb38 C T 9: 96,569,699 (GRCm39) V462M probably damaging Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25,804,624 (GRCm39) missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25,874,965 (GRCm39) unclassified probably benign
R1757:Lmf1 UTSW 17 25,874,184 (GRCm39) missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25,831,309 (GRCm39) missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3797:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25,873,455 (GRCm39) missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25,873,455 (GRCm39) missense probably damaging 1.00
R4293:Lmf1 UTSW 17 25,873,455 (GRCm39) missense probably damaging 1.00
R4636:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R4698:Lmf1 UTSW 17 25,798,324 (GRCm39) missense probably damaging 0.98
R4791:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25,804,592 (GRCm39) missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25,807,650 (GRCm39) nonsense probably null
R5047:Lmf1 UTSW 17 25,850,812 (GRCm39) intron probably benign
R5152:Lmf1 UTSW 17 25,874,493 (GRCm39) missense probably damaging 0.99
R5419:Lmf1 UTSW 17 25,881,610 (GRCm39) missense possibly damaging 0.94
R6162:Lmf1 UTSW 17 25,831,368 (GRCm39) missense probably benign 0.00
R6693:Lmf1 UTSW 17 25,864,252 (GRCm39) missense probably benign 0.00
R7583:Lmf1 UTSW 17 25,874,423 (GRCm39) missense
R7642:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25,873,582 (GRCm39) critical splice donor site probably null
R7671:Lmf1 UTSW 17 25,798,323 (GRCm39) missense possibly damaging 0.75
R7818:Lmf1 UTSW 17 25,881,565 (GRCm39) missense probably benign 0.30
R8851:Lmf1 UTSW 17 25,804,680 (GRCm39) nonsense probably null
R9181:Lmf1 UTSW 17 25,804,718 (GRCm39) missense probably damaging 0.99
R9524:Lmf1 UTSW 17 25,881,514 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGACCAGAACTGAGAG -3'
(R):5'- TTTCATGAGGCTTAGGCAGGAG -3'

Sequencing Primer
(F):5'- CTTGGGACCAGAACTGAGAGAATGG -3'
(R):5'- GCTTAGGCAGGAGGGTCATG -3'
Posted On 2014-11-12