Incidental Mutation 'R1411:Slc25a23'
ID250599
Institutional Source Beutler Lab
Gene Symbol Slc25a23
Ensembl Gene ENSMUSG00000046329
Gene Namesolute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1411 (G1)
Quality Score40
Status Validated
Chromosome17
Chromosomal Location57043711-57059863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57059622 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 18 (F18L)
Ref Sequence ENSEMBL: ENSMUSP00000040198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040280] [ENSMUST00000071826] [ENSMUST00000097299] [ENSMUST00000163628] [ENSMUST00000163763] [ENSMUST00000169543]
Predicted Effect probably damaging
Transcript: ENSMUST00000040280
AA Change: F18L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040198
Gene: ENSMUSG00000046329
AA Change: F18L

DomainStartEndE-ValueType
EFh 13 41 2.72e-3 SMART
EFh 80 108 1.09e0 SMART
EFh 116 144 3.07e1 SMART
Pfam:Mito_carr 181 273 3.8e-25 PFAM
Pfam:Mito_carr 274 366 4.1e-26 PFAM
Pfam:Mito_carr 372 465 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071826
SMART Domains Protein: ENSMUSP00000071729
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097299
SMART Domains Protein: ENSMUSP00000094902
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163628
SMART Domains Protein: ENSMUSP00000126402
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1fwxa1 30 52 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163763
SMART Domains Protein: ENSMUSP00000132502
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165187
Predicted Effect probably benign
Transcript: ENSMUST00000169543
SMART Domains Protein: ENSMUSP00000125760
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171128
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mitochondrial function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Slc25a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Slc25a23 APN 17 57047233 missense probably benign 0.01
IGL01614:Slc25a23 APN 17 57045579 missense probably null 0.98
IGL01919:Slc25a23 APN 17 57047291 missense possibly damaging 0.61
IGL01933:Slc25a23 APN 17 57052813 nonsense probably null
IGL02297:Slc25a23 APN 17 57053324 missense probably benign 0.00
R1317:Slc25a23 UTSW 17 57053888 missense possibly damaging 0.63
R1577:Slc25a23 UTSW 17 57047306 missense probably benign 0.00
R2156:Slc25a23 UTSW 17 57045562 missense probably benign 0.00
R4581:Slc25a23 UTSW 17 57052740 missense probably damaging 0.96
R4755:Slc25a23 UTSW 17 57052794 missense possibly damaging 0.92
R4786:Slc25a23 UTSW 17 57047326 missense possibly damaging 0.68
R4789:Slc25a23 UTSW 17 57059597 missense probably damaging 1.00
R5402:Slc25a23 UTSW 17 57053336 missense probably benign 0.07
R5423:Slc25a23 UTSW 17 57053597 missense probably damaging 0.99
R5478:Slc25a23 UTSW 17 57052780 missense probably damaging 1.00
R5659:Slc25a23 UTSW 17 57045500 unclassified probably benign
R5787:Slc25a23 UTSW 17 57053825 missense probably damaging 1.00
R6417:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6420:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6462:Slc25a23 UTSW 17 57052720 missense probably damaging 1.00
R6830:Slc25a23 UTSW 17 57053804 nonsense probably null
R6858:Slc25a23 UTSW 17 57058171 missense probably damaging 1.00
X0026:Slc25a23 UTSW 17 57055350 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCTCCAGCAAGGATGTGAAGTTGTG -3'
(R):5'- GCATTTATCACTTCCAGCAAGTGCC -3'

Sequencing Primer
(F):5'- CCAGTAGGCATCCCACagg -3'
(R):5'- GCACTGAAGAGGCTGCG -3'
Posted On2014-11-21