Incidental Mutation 'R2483:Xirp2'
ID250628
Institutional Source Beutler Lab
Gene Symbol Xirp2
Ensembl Gene ENSMUSG00000027022
Gene Namexin actin-binding repeat containing 2
Synonyms2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta
MMRRC Submission 040407-MU
Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198

Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R2483 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location67446002-67526614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67524992 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 3366 (T3366S)
Ref Sequence ENSEMBL: ENSMUSP00000028410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]
Predicted Effect probably benign
Transcript: ENSMUST00000028410
AA Change: T3366S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: T3366S

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4e-9 PFAM
Pfam:Xin 384 398 7.6e-10 PFAM
Pfam:Xin 420 435 6.4e-9 PFAM
Pfam:Xin 458 473 5.3e-9 PFAM
Pfam:Xin 536 551 4.1e-12 PFAM
Pfam:Xin 574 588 2.1e-8 PFAM
Pfam:Xin 609 623 6e-9 PFAM
Pfam:Xin 642 656 5.6e-8 PFAM
Pfam:Xin 679 693 5.9e-8 PFAM
Pfam:Xin 784 799 1.1e-10 PFAM
Pfam:Xin 822 837 3.9e-11 PFAM
Pfam:Xin 861 875 8.6e-12 PFAM
Pfam:Xin 894 909 2.8e-10 PFAM
Pfam:Xin 1006 1021 3.1e-9 PFAM
Pfam:Xin 1079 1094 6.7e-10 PFAM
Pfam:Xin 1117 1132 1.5e-10 PFAM
Pfam:Xin 1154 1169 2.4e-8 PFAM
Pfam:Xin 1256 1271 4.6e-8 PFAM
Pfam:Xin 1292 1305 1.6e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
LIM 3256 3308 4.45e-12 SMART
low complexity region 3356 3367 N/A INTRINSIC
low complexity region 3549 3565 N/A INTRINSIC
low complexity region 3614 3625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112347
SMART Domains Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4.3e-8 PFAM
Pfam:Xin 383 398 6.9e-9 PFAM
Pfam:Xin 420 435 1.8e-8 PFAM
Pfam:Xin 458 473 6.9e-8 PFAM
Pfam:Xin 536 551 2.8e-10 PFAM
Pfam:Xin 608 623 2.4e-8 PFAM
Pfam:Xin 642 657 1.7e-7 PFAM
Pfam:Xin 784 799 3.5e-9 PFAM
Pfam:Xin 822 837 8.9e-10 PFAM
Pfam:Xin 861 876 3.9e-10 PFAM
Pfam:Xin 894 909 5.4e-9 PFAM
Pfam:Xin 1006 1021 6.2e-8 PFAM
Pfam:Xin 1079 1094 2.4e-8 PFAM
Pfam:Xin 1117 1132 9.5e-9 PFAM
Pfam:Xin 1291 1306 5.8e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik A T 9: 20,873,177 I186F possibly damaging Het
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Ano6 A T 15: 95,965,974 T792S probably benign Het
Atm A T 9: 53,510,266 V715D probably damaging Het
Avl9 A G 6: 56,736,843 D362G probably benign Het
Bin1 T A 18: 32,414,227 S152R probably damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Btrc A G 19: 45,516,058 D397G probably damaging Het
C530008M17Rik A T 5: 76,856,409 I206F probably damaging Het
Cables2 A T 2: 180,260,429 V379E probably damaging Het
Cacna2d2 T C 9: 107,512,022 L228P probably damaging Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cdh26 A T 2: 178,466,589 S327C probably damaging Het
Cep78 T C 19: 15,960,980 K535E probably damaging Het
Ces1a A G 8: 93,027,341 Y345H probably damaging Het
Col6a5 C A 9: 105,864,148 R2524I probably damaging Het
Dctn1 G A 6: 83,194,187 R661H probably damaging Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emx1 T C 6: 85,188,255 S105P probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Fam193a A T 5: 34,465,758 K1230M possibly damaging Het
Fgf9 A G 14: 58,109,571 Q207R probably benign Het
Gm5460 G A 14: 34,045,818 C461Y possibly damaging Het
Gpc1 T C 1: 92,855,938 I249T probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igfn1 T C 1: 135,969,537 E1097G probably benign Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Kcnh5 A T 12: 75,114,471 I221N probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kyat1 T C 2: 30,186,698 H218R possibly damaging Het
Lamb2 T G 9: 108,480,559 C94G probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Myh1 A T 11: 67,211,226 M811L probably benign Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Myo15b A G 11: 115,864,739 T979A probably benign Het
Myo18b A T 5: 112,858,408 C879S probably damaging Het
Myom1 A G 17: 71,077,812 T733A probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nectin3 A G 16: 46,395,179 C74R possibly damaging Het
Obscn A G 11: 59,080,146 F2514L probably damaging Het
Olfr1241 G A 2: 89,483,127 Q3* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcdha5 G T 18: 36,961,489 M350I probably benign Het
Pcdha5 G A 18: 36,961,781 V448M probably damaging Het
Pex12 C T 11: 83,297,629 R180H possibly damaging Het
Pkd1l1 A T 11: 8,962,701 V168E probably damaging Het
Prokr2 T A 2: 132,381,175 D149V probably damaging Het
Rnf123 A G 9: 108,063,521 V707A probably benign Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Scarf1 T C 11: 75,515,291 F134L probably damaging Het
Sfxn5 A G 6: 85,332,278 probably null Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Snapc1 A G 12: 73,964,643 T28A probably benign Het
Soat1 T C 1: 156,431,099 Y528C probably damaging Het
Spem1 G A 11: 69,821,518 R107C possibly damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Sycp2 A T 2: 178,374,595 N691K probably damaging Het
Syne2 A T 12: 76,095,537 I6183F probably damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Tenm3 G A 8: 48,240,270 T1859I probably damaging Het
Thsd7b T A 1: 130,103,072 V1048D probably damaging Het
Tmem55b C G 14: 50,930,292 V59L probably damaging Het
Ttc37 A G 13: 76,182,867 E1472G probably damaging Het
Vav3 T C 3: 109,341,166 L43P probably damaging Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Wwp2 A G 8: 107,548,535 D388G probably damaging Het
Zbtb49 A C 5: 38,203,357 probably benign Het
Other mutations in Xirp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Xirp2 APN 2 67513375 missense probably benign 0.37
IGL00336:Xirp2 APN 2 67512598 missense possibly damaging 0.93
IGL00596:Xirp2 APN 2 67514882 missense probably benign 0.08
IGL00862:Xirp2 APN 2 67516903 missense probably benign 0.00
IGL01124:Xirp2 APN 2 67508615 missense probably damaging 0.99
IGL01289:Xirp2 APN 2 67513181 missense probably damaging 0.99
IGL01293:Xirp2 APN 2 67515184 missense possibly damaging 0.51
IGL01372:Xirp2 APN 2 67513990 missense possibly damaging 0.93
IGL01385:Xirp2 APN 2 67509677 missense probably damaging 0.99
IGL01411:Xirp2 APN 2 67514083 missense probably benign 0.00
IGL01413:Xirp2 APN 2 67509926 missense probably damaging 1.00
IGL01551:Xirp2 APN 2 67513505 missense probably benign
IGL01672:Xirp2 APN 2 67508502 missense probably benign
IGL01724:Xirp2 APN 2 67526067 missense probably benign
IGL01739:Xirp2 APN 2 67515138 missense probably benign 0.15
IGL01807:Xirp2 APN 2 67515031 missense probably benign
IGL02006:Xirp2 APN 2 67511962 missense possibly damaging 0.85
IGL02030:Xirp2 APN 2 67508981 missense probably benign 0.06
IGL02066:Xirp2 APN 2 67526071 missense probably benign
IGL02138:Xirp2 APN 2 67516956 missense probably benign 0.15
IGL02250:Xirp2 APN 2 67514012 missense probably benign 0.03
IGL02265:Xirp2 APN 2 67517150 missense possibly damaging 0.94
IGL02274:Xirp2 APN 2 67508651 missense probably benign 0.12
IGL02322:Xirp2 APN 2 67508738 missense probably benign 0.00
IGL02327:Xirp2 APN 2 67510100 missense probably damaging 1.00
IGL02378:Xirp2 APN 2 67513768 missense probably benign 0.00
IGL02492:Xirp2 APN 2 67516167 missense probably damaging 0.99
IGL02549:Xirp2 APN 2 67513102 missense probably benign 0.03
IGL02578:Xirp2 APN 2 67511247 missense probably damaging 0.96
IGL02635:Xirp2 APN 2 67507910 missense possibly damaging 0.86
IGL02654:Xirp2 APN 2 67514671 missense possibly damaging 0.86
IGL02663:Xirp2 APN 2 67509458 missense possibly damaging 0.92
IGL02795:Xirp2 APN 2 67509136 missense probably damaging 1.00
IGL02934:Xirp2 APN 2 67515676 missense probably benign 0.33
IGL03003:Xirp2 APN 2 67515562 missense possibly damaging 0.93
IGL03069:Xirp2 APN 2 67509532 missense possibly damaging 0.91
IGL03286:Xirp2 APN 2 67516310 missense probably damaging 0.99
IGL03326:Xirp2 APN 2 67482246 missense probably benign 0.01
IGL03381:Xirp2 APN 2 67514226 missense probably benign 0.34
IGL03394:Xirp2 APN 2 67515194 missense probably damaging 0.99
3-1:Xirp2 UTSW 2 67508198 missense possibly damaging 0.95
H8562:Xirp2 UTSW 2 67515457 missense probably benign
PIT4142001:Xirp2 UTSW 2 67519362 splice site probably benign
R0015:Xirp2 UTSW 2 67510899 nonsense probably null
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0066:Xirp2 UTSW 2 67512140 missense possibly damaging 0.85
R0109:Xirp2 UTSW 2 67519278 missense probably damaging 1.00
R0111:Xirp2 UTSW 2 67508378 missense probably damaging 0.99
R0115:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0117:Xirp2 UTSW 2 67517120 missense possibly damaging 0.94
R0133:Xirp2 UTSW 2 67517124 missense probably benign
R0282:Xirp2 UTSW 2 67513380 missense probably damaging 0.96
R0463:Xirp2 UTSW 2 67514918 missense probably benign 0.02
R0481:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0488:Xirp2 UTSW 2 67514821 missense possibly damaging 0.90
R0548:Xirp2 UTSW 2 67514414 missense probably benign 0.00
R0557:Xirp2 UTSW 2 67516351 missense probably benign 0.33
R0582:Xirp2 UTSW 2 67508866 missense probably benign
R0723:Xirp2 UTSW 2 67512215 missense probably damaging 0.98
R0835:Xirp2 UTSW 2 67507910 missense possibly damaging 0.86
R1160:Xirp2 UTSW 2 67509887 missense possibly damaging 0.92
R1189:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R1474:Xirp2 UTSW 2 67525067 missense probably benign 0.00
R1513:Xirp2 UTSW 2 67511530 missense probably benign 0.00
R1514:Xirp2 UTSW 2 67514323 nonsense probably null
R1519:Xirp2 UTSW 2 67515679 missense probably benign 0.44
R1532:Xirp2 UTSW 2 67513939 missense probably benign 0.00
R1537:Xirp2 UTSW 2 67510013 missense probably damaging 0.98
R1541:Xirp2 UTSW 2 67512290 missense possibly damaging 0.70
R1543:Xirp2 UTSW 2 67508039 missense probably benign
R1607:Xirp2 UTSW 2 67510295 nonsense probably null
R1620:Xirp2 UTSW 2 67510835 missense probably damaging 0.98
R1709:Xirp2 UTSW 2 67509871 missense probably benign 0.33
R1713:Xirp2 UTSW 2 67512418 missense probably benign 0.25
R1828:Xirp2 UTSW 2 67515238 missense possibly damaging 0.86
R1834:Xirp2 UTSW 2 67511140 missense probably damaging 0.99
R1905:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1907:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1943:Xirp2 UTSW 2 67512615 missense probably benign 0.34
R1971:Xirp2 UTSW 2 67511695 missense possibly damaging 0.48
R1998:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R2075:Xirp2 UTSW 2 67510201 missense probably benign 0.33
R2132:Xirp2 UTSW 2 67508048 missense possibly damaging 0.72
R2175:Xirp2 UTSW 2 67509914 missense probably damaging 0.99
R2310:Xirp2 UTSW 2 67526247 missense probably benign 0.19
R2338:Xirp2 UTSW 2 67510770 missense probably damaging 0.98
R2426:Xirp2 UTSW 2 67514471 missense probably benign 0.02
R3084:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R3113:Xirp2 UTSW 2 67510147 missense probably benign 0.33
R3903:Xirp2 UTSW 2 67508036 missense probably benign 0.40
R3916:Xirp2 UTSW 2 67511422 missense probably benign 0.25
R3928:Xirp2 UTSW 2 67511669 missense possibly damaging 0.85
R4025:Xirp2 UTSW 2 67511402 missense probably benign 0.12
R4135:Xirp2 UTSW 2 67525397 missense probably benign 0.00
R4223:Xirp2 UTSW 2 67516493 missense possibly damaging 0.66
R4257:Xirp2 UTSW 2 67516039 missense probably benign 0.31
R4499:Xirp2 UTSW 2 67513438 missense probably benign 0.08
R4577:Xirp2 UTSW 2 67513897 missense probably damaging 0.99
R4739:Xirp2 UTSW 2 67519265 missense probably damaging 0.99
R4758:Xirp2 UTSW 2 67516535 missense probably damaging 0.98
R4834:Xirp2 UTSW 2 67516406 missense probably benign 0.26
R4855:Xirp2 UTSW 2 67511064 missense possibly damaging 0.96
R4923:Xirp2 UTSW 2 67512893 missense probably benign
R4936:Xirp2 UTSW 2 67509819 missense possibly damaging 0.85
R5032:Xirp2 UTSW 2 67525670 missense possibly damaging 0.84
R5049:Xirp2 UTSW 2 67517134 missense probably benign 0.03
R5077:Xirp2 UTSW 2 67514477 missense probably benign
R5090:Xirp2 UTSW 2 67525470 missense possibly damaging 0.83
R5107:Xirp2 UTSW 2 67509710 missense probably damaging 0.99
R5107:Xirp2 UTSW 2 67511861 missense probably damaging 1.00
R5187:Xirp2 UTSW 2 67515367 missense probably benign 0.01
R5241:Xirp2 UTSW 2 67482360 nonsense probably null
R5307:Xirp2 UTSW 2 67511162 missense probably damaging 0.99
R5342:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R5370:Xirp2 UTSW 2 67512152 missense possibly damaging 0.72
R5375:Xirp2 UTSW 2 67511906 missense probably damaging 0.99
R5407:Xirp2 UTSW 2 67510969 missense probably benign 0.33
R5514:Xirp2 UTSW 2 67505121 missense probably benign 0.03
R5531:Xirp2 UTSW 2 67515302 missense probably benign 0.42
R5590:Xirp2 UTSW 2 67514035 missense probably benign 0.23
R5646:Xirp2 UTSW 2 67510790 missense probably damaging 0.99
R5649:Xirp2 UTSW 2 67516895 missense probably benign 0.00
R5686:Xirp2 UTSW 2 67482298 missense probably damaging 0.99
R5761:Xirp2 UTSW 2 67510967 missense probably benign 0.00
R5777:Xirp2 UTSW 2 67510004 missense possibly damaging 0.92
R5785:Xirp2 UTSW 2 67509662 missense probably damaging 0.96
R5843:Xirp2 UTSW 2 67476785 start gained probably benign
R5846:Xirp2 UTSW 2 67509243 missense probably damaging 0.98
R5875:Xirp2 UTSW 2 67505080 missense probably benign 0.00
R5896:Xirp2 UTSW 2 67508698 missense probably benign 0.32
R5896:Xirp2 UTSW 2 67509946 missense possibly damaging 0.91
R5901:Xirp2 UTSW 2 67513066 missense possibly damaging 0.91
R5934:Xirp2 UTSW 2 67524804 missense possibly damaging 0.92
R5950:Xirp2 UTSW 2 67511320 missense possibly damaging 0.95
R5996:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6013:Xirp2 UTSW 2 67510943 missense possibly damaging 0.48
R6048:Xirp2 UTSW 2 67508243 missense possibly damaging 0.96
R6111:Xirp2 UTSW 2 67511817 missense possibly damaging 0.86
R6180:Xirp2 UTSW 2 67505577 critical splice donor site probably null
R6342:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6346:Xirp2 UTSW 2 67516081 missense probably benign 0.00
R6603:Xirp2 UTSW 2 67516544 missense probably benign
R6604:Xirp2 UTSW 2 67509845 missense possibly damaging 0.86
R6669:Xirp2 UTSW 2 67513355 missense possibly damaging 0.78
R6701:Xirp2 UTSW 2 67516225 missense possibly damaging 0.94
R6726:Xirp2 UTSW 2 67512868 missense possibly damaging 0.88
R6833:Xirp2 UTSW 2 67509950 missense probably benign 0.12
R6897:Xirp2 UTSW 2 67508567 missense probably damaging 1.00
R6933:Xirp2 UTSW 2 67514857 missense probably benign 0.34
X0063:Xirp2 UTSW 2 67516123 missense probably benign 0.04
X0065:Xirp2 UTSW 2 67515118 missense probably benign 0.34
Z1088:Xirp2 UTSW 2 67513321 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGAAATTACGCATCACTTCACG -3'
(R):5'- AACAGGGATGGTCACTTCAGG -3'

Sequencing Primer
(F):5'- TTCACGGACGAATATACTGCAAG -3'
(R):5'- TCACTTCAGGCGGCCACTTAG -3'
Posted On2014-12-04