Incidental Mutation 'R2484:Rrh'
ID250788
Institutional Source Beutler Lab
Gene Symbol Rrh
Ensembl Gene ENSMUSG00000028012
Gene Nameretinal pigment epithelium derived rhodopsin homolog
SynonymsPeropsin
MMRRC Submission 040408-MU
Accession Numbers

Genbank: NM_009102.3; Ensembl: ENSMUST00000029648, ENSMUST00000078035 ,ENSMUST00000090295, ENSMUST00000171313

Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R2484 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129804408-129822587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129822391 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 31 (Y31C)
Ref Sequence ENSEMBL: ENSMUSP00000143093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029643] [ENSMUST00000029648] [ENSMUST00000134174] [ENSMUST00000149071] [ENSMUST00000171313] [ENSMUST00000196902] [ENSMUST00000200079]
Predicted Effect probably benign
Transcript: ENSMUST00000029643
SMART Domains Protein: ENSMUSP00000029643
Gene: ENSMUSG00000028010

DomainStartEndE-ValueType
Pfam:Gar1 63 180 2.6e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000029648
AA Change: Y31C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029648
Gene: ENSMUSG00000028012
AA Change: Y31C

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128441
Predicted Effect probably benign
Transcript: ENSMUST00000134174
SMART Domains Protein: ENSMUSP00000115191
Gene: ENSMUSG00000028010

DomainStartEndE-ValueType
Pfam:Gar1 1 79 2.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143545
Predicted Effect probably benign
Transcript: ENSMUST00000149071
SMART Domains Protein: ENSMUSP00000118752
Gene: ENSMUSG00000028010

DomainStartEndE-ValueType
Pfam:Gar1 57 198 1.6e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171313
AA Change: Y31C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132360
Gene: ENSMUSG00000028012
AA Change: Y31C

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 4.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196317
Predicted Effect probably damaging
Transcript: ENSMUST00000196902
AA Change: Y31C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143093
Gene: ENSMUSG00000028012
AA Change: Y31C

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197295
Predicted Effect unknown
Transcript: ENSMUST00000197535
AA Change: Y24C
Predicted Effect probably benign
Transcript: ENSMUST00000200079
AA Change: Y31C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143054
Gene: ENSMUSG00000028012
AA Change: Y31C

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7tm_1 30 197 3.1e-22 PFAM
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This gene belongs to the seven-exon subfamily of mammalian opsin genes that includes opsin 5 and retinal G protein coupled receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,641 N252S probably benign Het
4932414N04Rik G A 2: 68,711,475 D46N possibly damaging Het
A830018L16Rik G T 1: 11,596,302 A278S probably damaging Het
Adarb2 A T 13: 8,569,774 K99* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn1l A G 8: 109,732,251 S460P probably damaging Het
Bicra T A 7: 15,988,680 N304I possibly damaging Het
Capn10 A T 1: 92,944,843 D470V probably damaging Het
Chchd3 A G 6: 32,804,015 Y184H possibly damaging Het
Col6a6 T C 9: 105,780,804 I736M probably damaging Het
Dhx36 T A 3: 62,472,815 N820I probably damaging Het
Drd4 C T 7: 141,294,736 P347S probably benign Het
Ephx1 A T 1: 180,989,972 V378D probably damaging Het
Extl3 A T 14: 65,075,735 V666E probably damaging Het
Fam20c G C 5: 138,809,117 R500S probably benign Het
Glod4 A T 11: 76,239,518 D42E probably damaging Het
Golga2 T C 2: 32,304,770 I643T probably benign Het
Hnf1b A T 11: 83,861,835 T73S probably benign Het
Hydin A G 8: 110,513,115 Y2009C possibly damaging Het
Ido2 A G 8: 24,533,815 C336R probably damaging Het
Ifngr1 T C 10: 19,601,415 V108A probably damaging Het
Igbp1b A T 6: 138,657,494 N317K probably benign Het
Ints14 A G 9: 64,986,084 S511G probably benign Het
Itpr1 T C 6: 108,369,110 S125P probably damaging Het
Jag1 T C 2: 137,084,700 T975A possibly damaging Het
Klra17 A G 6: 129,868,757 W165R probably damaging Het
Leo1 T A 9: 75,445,473 N99K possibly damaging Het
Lonp1 C A 17: 56,614,659 G883C probably damaging Het
Lpin1 C A 12: 16,547,499 G682W probably damaging Het
Macf1 A C 4: 123,473,672 L2432R probably damaging Het
Med12l T G 3: 59,297,838 I2075M probably benign Het
Mroh6 A G 15: 75,884,328 S660P probably benign Het
Myh6 G T 14: 54,961,242 Y309* probably null Het
Myof C T 19: 37,903,843 R1154H probably benign Het
Myrip G A 9: 120,424,619 E253K probably benign Het
Ndst3 T C 3: 123,552,537 D281G possibly damaging Het
Nipbl T C 15: 8,323,698 K1788R probably damaging Het
Nol12 A G 15: 78,940,517 probably benign Het
Nptn A G 9: 58,643,673 T212A possibly damaging Het
Nptx2 C T 5: 144,556,345 A414V probably damaging Het
Nub1 A G 5: 24,708,702 D503G possibly damaging Het
Obscn T A 11: 59,007,540 probably benign Het
Olfr1253 A G 2: 89,752,234 I198T probably benign Het
Olfr1447 C T 19: 12,901,641 M46I probably benign Het
Olfr635 A G 7: 103,979,338 T49A probably benign Het
Pcnx2 T C 8: 125,891,120 E132G probably damaging Het
Pkdcc A G 17: 83,222,238 probably benign Het
Prdm2 T A 4: 143,135,206 I505F probably damaging Het
Psmc3 C G 2: 91,056,001 Q169E probably damaging Het
Ptger4 A T 15: 5,235,173 I334N probably benign Het
Ptrh1 T C 2: 32,777,171 M161T probably benign Het
Rapgef6 T A 11: 54,642,756 V482D possibly damaging Het
Rdh16f2 T C 10: 127,875,077 S188P probably damaging Het
Selp G T 1: 164,143,954 W659L probably benign Het
Selp G T 1: 164,143,955 W659C probably damaging Het
Shh A G 5: 28,466,742 C8R probably benign Het
Spdye4b C A 5: 143,202,093 S167R possibly damaging Het
Strip1 T C 3: 107,628,221 Y62C possibly damaging Het
Sucla2 A T 14: 73,581,709 I232F probably benign Het
Sugp1 A G 8: 70,069,524 D437G possibly damaging Het
Taf1a A G 1: 183,396,084 probably benign Het
Tbc1d20 T A 2: 152,311,363 M271K probably damaging Het
Tecpr2 T C 12: 110,933,318 S707P probably benign Het
Tert G A 13: 73,647,985 R1017H probably benign Het
Tox C G 4: 6,688,886 V493L probably damaging Het
Tpo C T 12: 30,103,969 A246T probably benign Het
Traf7 A T 17: 24,511,639 V358D probably damaging Het
Trim56 C T 5: 137,112,674 V663M possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usf3 C T 16: 44,220,682 H1842Y probably damaging Het
Uvrag T C 7: 98,888,461 E509G probably benign Het
Vmn2r5 T C 3: 64,503,971 D305G possibly damaging Het
Vmn2r52 T C 7: 10,169,131 R457G probably damaging Het
Vti1a A C 19: 55,380,979 N101T possibly damaging Het
Zfp236 A G 18: 82,668,637 F259L probably benign Het
Other mutations in Rrh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Rrh APN 3 129822425 missense possibly damaging 0.53
IGL01368:Rrh APN 3 129808969 missense probably benign 0.02
IGL02206:Rrh APN 3 129811697 missense probably benign 0.40
IGL02577:Rrh APN 3 129815723 missense probably damaging 0.98
B6584:Rrh UTSW 3 129811742 missense probably damaging 1.00
R1822:Rrh UTSW 3 129812633 missense probably damaging 0.99
R2114:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2115:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2116:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2913:Rrh UTSW 3 129815609 missense probably damaging 0.99
R3236:Rrh UTSW 3 129811711 missense probably damaging 1.00
R3237:Rrh UTSW 3 129811711 missense probably damaging 1.00
R5221:Rrh UTSW 3 129815631 missense probably damaging 0.99
R5270:Rrh UTSW 3 129813349 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAACCACGATGCACACTCTG -3'
(R):5'- TTCTTTGAGGTCTACAAGCGG -3'

Sequencing Primer
(F):5'- GCACACTCTGCTCATGAATTTAAGG -3'
(R):5'- TCTTTGAGGTCTACAAGCGGAAATG -3'
Posted On2014-12-04