Incidental Mutation 'R0310:Rbm12'
ID25086
Institutional Source Beutler Lab
Gene Symbol Rbm12
Ensembl Gene ENSMUSG00000089824
Gene NameRNA binding motif protein 12
SynonymsSWAN, 5730420G12Rik, 9430070C08Rik
MMRRC Submission 038520-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R0310 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156091958-156111978 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 156095724 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059647] [ENSMUST00000079312] [ENSMUST00000109604] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000128499] [ENSMUST00000131377] [ENSMUST00000132494] [ENSMUST00000133921] [ENSMUST00000136296] [ENSMUST00000138068] [ENSMUST00000142960] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000154889] [ENSMUST00000183518] [ENSMUST00000183972] [ENSMUST00000184152] [ENSMUST00000184265] [ENSMUST00000184899]
Predicted Effect unknown
Transcript: ENSMUST00000059647
AA Change: L876P
SMART Domains Protein: ENSMUSP00000050461
Gene: ENSMUSG00000089824
AA Change: L876P

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109604
AA Change: L876P
SMART Domains Protein: ENSMUSP00000105233
Gene: ENSMUSG00000089824
AA Change: L876P

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.1e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127956
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128499
SMART Domains Protein: ENSMUSP00000118067
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 6e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131377
SMART Domains Protein: ENSMUSP00000120731
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 1e-7 PDB
Blast:RRM_2 4 72 4e-29 BLAST
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132494
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133921
SMART Domains Protein: ENSMUSP00000122644
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Pfam:C2 139 178 3.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138068
SMART Domains Protein: ENSMUSP00000119519
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 5e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154889
SMART Domains Protein: ENSMUSP00000118140
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183518
SMART Domains Protein: ENSMUSP00000139010
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 40 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183972
Predicted Effect probably benign
Transcript: ENSMUST00000184152
SMART Domains Protein: ENSMUSP00000139035
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184899
SMART Domains Protein: ENSMUSP00000139177
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 54 2e-25 BLAST
SCOP:d2u1a__ 9 68 6e-3 SMART
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.3%
  • 20x: 82.5%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 2 H2. Two alternatively spliced transcript variants have been identified for this gene. Both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit open neural tube and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,425,671 T92P probably damaging Het
9530053A07Rik G T 7: 28,142,274 V545L probably benign Het
Abca13 T C 11: 9,293,810 V1891A probably benign Het
Abcc1 T A 16: 14,410,927 I346N probably damaging Het
Afdn G T 17: 13,885,508 probably null Het
Ahrr G A 13: 74,283,024 probably benign Het
Akap13 A G 7: 75,614,930 D507G probably damaging Het
Akap8 A T 17: 32,316,260 M260K possibly damaging Het
Akr1b8 T C 6: 34,365,259 V265A probably benign Het
Alpk3 C G 7: 81,078,610 P496R possibly damaging Het
Ankrd13b A G 11: 77,472,745 V249A possibly damaging Het
Arid4a T C 12: 71,075,830 V995A probably benign Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atad2 G A 15: 58,114,257 A499V probably damaging Het
Barhl2 G T 5: 106,457,387 A152E possibly damaging Het
Bbs12 T A 3: 37,321,045 D547E probably damaging Het
Btaf1 A G 19: 37,004,534 M1655V probably damaging Het
Ccdc50 T A 16: 27,406,658 H40Q probably damaging Het
Ccr9 A T 9: 123,774,552 probably benign Het
Cdh15 A G 8: 122,865,436 D654G probably damaging Het
Cebpz T C 17: 78,926,124 D758G probably damaging Het
Cgn C T 3: 94,765,653 R906K possibly damaging Het
Chil3 T A 3: 106,160,523 M109L possibly damaging Het
Cntnap4 A T 8: 112,842,516 probably null Het
Cyp4f18 C T 8: 72,001,012 probably benign Het
Daam2 A G 17: 49,463,924 probably null Het
Ddost T A 4: 138,310,611 H220Q probably benign Het
Dennd2a C T 6: 39,464,201 probably benign Het
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dnah5 A T 15: 28,299,110 R1539S probably benign Het
Dusp22 T C 13: 30,705,658 I74T probably damaging Het
Dyx1c1 A T 9: 72,972,336 D386V probably damaging Het
E130309D02Rik G T 5: 143,307,888 T278K probably benign Het
Epc1 A G 18: 6,440,202 probably benign Het
Epha7 A G 4: 28,961,301 I845V probably benign Het
Fanci C T 7: 79,407,417 probably benign Het
Fbn1 T A 2: 125,363,644 E1104V probably damaging Het
Fbxo8 T A 8: 56,590,097 F205L probably damaging Het
Fetub T C 16: 22,929,756 probably benign Het
Frs3 T C 17: 47,703,822 V480A probably benign Het
Gne C A 4: 44,060,157 E79* probably null Het
Hrc T A 7: 45,336,497 H357Q probably benign Het
Idh1 T C 1: 65,161,920 M291V probably damaging Het
Iltifb T A 10: 118,293,185 H133L probably benign Het
Ino80b T C 6: 83,124,091 E165G probably damaging Het
Inppl1 A T 7: 101,828,499 probably benign Het
Ip6k2 T C 9: 108,799,233 probably benign Het
Itga11 A T 9: 62,760,346 I654F probably damaging Het
Jag2 G T 12: 112,913,377 probably benign Het
Katna1 G T 10: 7,743,749 probably benign Het
Kcnh4 G T 11: 100,746,169 S707Y probably benign Het
Kcnn2 T G 18: 45,560,518 L387R probably damaging Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Lama5 G T 2: 180,181,566 probably benign Het
Lmbr1l A T 15: 98,908,773 probably benign Het
Mast4 A T 13: 102,754,161 S870T possibly damaging Het
Med1 A G 11: 98,167,574 Y266H probably benign Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mgam T C 6: 40,761,035 probably benign Het
Mmp8 A G 9: 7,561,454 Q153R probably benign Het
Mpeg1 C A 19: 12,461,691 T171N probably benign Het
Mtus2 T C 5: 148,107,019 S806P probably benign Het
Naip2 T A 13: 100,148,842 E1226V probably damaging Het
Naip6 A G 13: 100,308,213 F246L possibly damaging Het
Nav3 T C 10: 109,767,128 I1187V possibly damaging Het
Nbeal1 T C 1: 60,305,370 probably benign Het
Nbeal2 C A 9: 110,638,163 V653L probably damaging Het
Ndufa9 G T 6: 126,827,532 probably benign Het
Nlrp5 G T 7: 23,430,157 C883F probably damaging Het
Nr0b2 C A 4: 133,555,992 probably null Het
Olfr24 T A 9: 18,755,333 M101L possibly damaging Het
Olfr799 T A 10: 129,647,731 V201E probably damaging Het
Olfr822 G A 10: 130,074,823 V138I probably benign Het
Olfr888 T A 9: 38,109,486 S267T possibly damaging Het
Pkhd1 A T 1: 20,549,822 probably null Het
Pkhd1l1 A G 15: 44,522,738 probably benign Het
Ppm1l A G 3: 69,549,461 K237R probably benign Het
Ppp1r18 T C 17: 35,873,711 probably benign Het
Ptpn3 A T 4: 57,204,958 D734E probably benign Het
Pxdn T C 12: 30,015,529 C1283R probably damaging Het
Rttn A T 18: 89,009,460 probably benign Het
Sgsm1 G T 5: 113,263,705 H431Q probably benign Het
Siah3 A G 14: 75,525,927 N206S possibly damaging Het
Slc22a15 G T 3: 101,860,511 D521E probably benign Het
Sprr2k A T 3: 92,433,463 probably benign Het
Stab2 G A 10: 86,967,613 probably benign Het
Sval3 T A 6: 41,968,186 L16Q probably damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Tk1 T C 11: 117,817,095 probably benign Het
Tlk2 C A 11: 105,254,973 A335E probably benign Het
Tmtc1 T C 6: 148,249,581 K659E probably benign Het
Tnk2 C T 16: 32,680,590 P907L probably benign Het
Trim14 C A 4: 46,522,043 K211N probably damaging Het
Trim15 A C 17: 36,866,986 L39R probably damaging Het
Tspan15 T A 10: 62,188,093 T269S probably benign Het
Ttc7 T A 17: 87,361,864 D646E probably benign Het
Ttll6 A T 11: 96,147,556 Q410L probably benign Het
Unc79 A G 12: 103,061,407 Q419R probably damaging Het
Vcam1 A T 3: 116,114,416 Y666N possibly damaging Het
Vmn1r10 A T 6: 57,113,501 Y26F probably damaging Het
Vmn1r80 A G 7: 12,193,848 N295S probably benign Het
Vmn2r114 A T 17: 23,290,943 H854Q probably benign Het
Vmn2r2 A T 3: 64,134,618 D225E probably damaging Het
Vmn2r4 A T 3: 64,389,434 Y643* probably null Het
Vmn2r52 T A 7: 10,159,466 Y582F probably damaging Het
Vmn2r60 G T 7: 42,195,140 L642F possibly damaging Het
Zbtb20 T C 16: 43,609,746 S207P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zkscan7 G T 9: 122,888,893 E118* probably null Het
Other mutations in Rbm12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Rbm12 APN 2 156096041 intron probably benign
IGL01307:Rbm12 APN 2 156095382 intron probably benign
IGL02474:Rbm12 APN 2 156098097 missense probably damaging 1.00
IGL02596:Rbm12 APN 2 156095560 intron probably benign
IGL02601:Rbm12 APN 2 156095560 intron probably benign
IGL02603:Rbm12 APN 2 156095560 intron probably benign
IGL02608:Rbm12 APN 2 156095898 intron probably benign
IGL02679:Rbm12 APN 2 156095560 intron probably benign
IGL02691:Rbm12 APN 2 156095560 intron probably benign
IGL02693:Rbm12 APN 2 156095560 intron probably benign
IGL02702:Rbm12 APN 2 156095560 intron probably benign
IGL02703:Rbm12 APN 2 156095560 intron probably benign
IGL03407:Rbm12 APN 2 156097564 nonsense probably null
IGL02991:Rbm12 UTSW 2 156095560 intron probably benign
R1213:Rbm12 UTSW 2 156097492 nonsense probably null
R1280:Rbm12 UTSW 2 156096829 missense probably damaging 1.00
R1511:Rbm12 UTSW 2 156097536 missense probably damaging 0.98
R1951:Rbm12 UTSW 2 156097213 missense probably damaging 0.99
R2131:Rbm12 UTSW 2 156095510 nonsense probably null
R2133:Rbm12 UTSW 2 156095510 nonsense probably null
R2883:Rbm12 UTSW 2 156097075 missense probably damaging 0.98
R4760:Rbm12 UTSW 2 156097128 missense probably damaging 0.99
R4783:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4784:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4785:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4794:Rbm12 UTSW 2 156095569 intron probably benign
R5057:Rbm12 UTSW 2 156096886 missense probably benign 0.18
R5383:Rbm12 UTSW 2 156103365 utr 5 prime probably benign
R5599:Rbm12 UTSW 2 156096793 nonsense probably null
R5979:Rbm12 UTSW 2 156097759 intron probably benign
R6083:Rbm12 UTSW 2 156097726 intron probably benign
R6769:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R6771:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCATCCCGAGATTCAAAGGCCAC -3'
(R):5'- CAATACCTGGTCCCGCAATACCTG -3'

Sequencing Primer
(F):5'- CTGAACCTGGAATTACTTGATAACC -3'
(R):5'- AGAAGAGCATGTCTTCTTGACTG -3'
Posted On2013-04-16