Incidental Mutation 'R2495:Helz2'
ID250931
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Namehelicase with zinc finger 2, transcriptional coactivator
SynonymsBC006779
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181227615-181242027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181232912 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1930 (S1930P)
Ref Sequence ENSEMBL: ENSMUSP00000104459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
Predicted Effect probably benign
Transcript: ENSMUST00000094203
AA Change: S1930P

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: S1930P

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: S1930P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: S1930P

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121484
AA Change: S1930P

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: S1930P

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGCACTTTGAAGCAGCG -3'
(R):5'- ATGACATGCACCCTTCACTG -3'

Sequencing Primer
(F):5'- AGCCCAGCTTGTTTTGAG -3'
(R):5'- CTTGCCTGGACTTGCGAAG -3'
Posted On2014-12-04