Mutagenetix > Incidental Mutation

Incidental Mutation 'R2680:Itgae'

250944

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

alpha-E1, CD103

MMRRC Submission

040433-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72981409-73038272 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73005752 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 305 (D305E)

Ref Sequence

ENSEMBL: ENSMUSP00000099596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

probably damaging
Transcript: ENSMUST00000006101
AA Change: D305E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: D305E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102537
AA Change: D305E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: D305E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
BC024139	A	G	15: 76,005,939 (GRCm39)	W421R	probably damaging	Het
Car11	T	C	7: 45,351,909 (GRCm39)	S113P	probably benign	Het
Ccdc146	C	T	5: 21,510,267 (GRCm39)	A582T	possibly damaging	Het
Cct8l1	A	G	5: 25,722,133 (GRCm39)	T283A	probably benign	Het
Ckap5	A	G	2: 91,419,043 (GRCm39)	I1118V	probably benign	Het
Copa	C	T	1: 171,948,971 (GRCm39)	Q1199*	probably null	Het
Cpd	A	T	11: 76,681,825 (GRCm39)	N1140K	probably benign	Het
Cspp1	A	G	1: 10,174,530 (GRCm39)	D661G	probably damaging	Het
Dab2	A	G	15: 6,466,474 (GRCm39)	Q729R	possibly damaging	Het
Dnah9	T	C	11: 65,924,751 (GRCm39)	I2168V	probably benign	Het
Dync1h1	G	A	12: 110,609,681 (GRCm39)	R2821H	probably damaging	Het
Ercc5	T	C	1: 44,196,133 (GRCm39)	V42A	probably benign	Het
Evc	A	G	5: 37,467,581 (GRCm39)	V566A	probably benign	Het
Fcrl2	T	C	3: 87,164,656 (GRCm39)	Y290C	probably damaging	Het
Frmd4a	A	G	2: 4,539,364 (GRCm39)	R171G	probably damaging	Het
Galnt17	G	A	5: 131,140,661 (GRCm39)	P152L	probably damaging	Het
Gfi1	A	G	5: 107,869,297 (GRCm39)	L245P	probably damaging	Het
Heatr4	T	C	12: 84,027,237 (GRCm39)	K7E	possibly damaging	Het
Ifit3b	A	G	19: 34,589,705 (GRCm39)	N294D	probably benign	Het
Ift74	A	G	4: 94,541,265 (GRCm39)	Y230C	probably damaging	Het
Igsf10	C	T	3: 59,232,875 (GRCm39)	V1953I	probably benign	Het
Ikzf5	T	C	7: 130,998,490 (GRCm39)	D14G	probably damaging	Het
Il12rb2	T	A	6: 67,331,789 (GRCm39)	T259S	possibly damaging	Het
Kif23	A	C	9: 61,844,758 (GRCm39)	D90E	probably benign	Het
Kprp	A	G	3: 92,731,770 (GRCm39)	F427L	unknown	Het
Lmnb1	T	A	18: 56,864,177 (GRCm39)	Y261N	probably damaging	Het
Megf8	T	C	7: 25,016,981 (GRCm39)	V17A	probably benign	Het
Mfap4	T	C	11: 61,378,057 (GRCm39)	Y190H	probably benign	Het
Mlh1	T	C	9: 111,065,085 (GRCm39)		probably null	Het
Mocos	C	A	18: 24,809,686 (GRCm39)	Q430K	probably damaging	Het
Ndst2	A	G	14: 20,774,822 (GRCm39)	F794L	probably damaging	Het
Nedd4l	A	T	18: 65,296,201 (GRCm39)	I197F	possibly damaging	Het
Nefm	A	G	14: 68,361,235 (GRCm39)	L343P	probably damaging	Het
Nfatc4	A	G	14: 56,070,291 (GRCm39)		probably benign	Het
Nlrp4a	T	A	7: 26,148,655 (GRCm39)		probably null	Het
Nlrp4f	A	T	13: 65,342,157 (GRCm39)	L496*	probably null	Het
Nom1	T	C	5: 29,648,415 (GRCm39)	F654S	probably damaging	Het
Or4k2	A	T	14: 50,424,304 (GRCm39)	Y123*	probably null	Het
Pcdhac2	A	G	18: 37,278,639 (GRCm39)	K540E	possibly damaging	Het
Pde4dip	T	C	3: 97,608,933 (GRCm39)	N1974S	possibly damaging	Het
Pik3c3	T	C	18: 30,477,131 (GRCm39)		probably null	Het
Pik3ca	C	T	3: 32,490,697 (GRCm39)	R115*	probably null	Het
Pik3ca	T	C	3: 32,498,034 (GRCm39)	I492T	probably benign	Het
Ppp1ca	G	A	19: 4,244,594 (GRCm39)	E218K	possibly damaging	Het
Prex1	G	T	2: 166,443,692 (GRCm39)	D492E	possibly damaging	Het
Scaf8	T	C	17: 3,247,866 (GRCm39)	V1063A	possibly damaging	Het
Scn3a	G	T	2: 65,366,880 (GRCm39)	N47K	probably benign	Het
Sec61a2	G	T	2: 5,878,556 (GRCm39)	N348K	probably benign	Het
Sh3rf2	A	G	18: 42,234,715 (GRCm39)	E166G	probably damaging	Het
Slc19a2	C	A	1: 164,076,982 (GRCm39)	T54K	probably damaging	Het
Slc8a3	T	A	12: 81,249,113 (GRCm39)	I765F	probably damaging	Het
Snap91	A	T	9: 86,761,603 (GRCm39)	M1K	probably null	Het
Spef1l	T	C	7: 139,558,474 (GRCm39)	D41G	probably damaging	Het
Strc	T	C	2: 121,195,592 (GRCm39)	H1619R	probably damaging	Het
Tbl1xr1	C	T	3: 22,245,615 (GRCm39)	T207M	possibly damaging	Het
Tchp	T	C	5: 114,847,580 (GRCm39)		probably null	Het
Tln1	A	T	4: 43,539,668 (GRCm39)	F1581Y	probably damaging	Het
Tnxb	T	C	17: 34,922,594 (GRCm39)	V2469A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798 (GRCm39)	P46S	probably benign	Het
Vmn1r225	T	A	17: 20,723,055 (GRCm39)	F165L	probably benign	Het
Vmn2r13	T	C	5: 109,322,178 (GRCm39)	D173G	possibly damaging	Het
Vmn2r6	A	C	3: 64,445,707 (GRCm39)	S673A	possibly damaging	Het
Vta1	G	A	10: 14,581,171 (GRCm39)		probably benign	Het
Wwc1	T	C	11: 35,766,756 (GRCm39)	T500A	probably benign	Het
Zfp784	T	A	7: 5,039,116 (GRCm39)	Q147H	possibly damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73,036,461 (GRCm39)	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73,004,520 (GRCm39)	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73,013,974 (GRCm39)	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73,010,263 (GRCm39)	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73,010,204 (GRCm39)	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73,002,585 (GRCm39)	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73,006,963 (GRCm39)	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73,009,010 (GRCm39)	missense	probably benign	0.29
IGL02149:Itgae	APN	11	72,994,720 (GRCm39)	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73,024,844 (GRCm39)	missense	probably benign	0.06
IGL02231:Itgae	APN	11	72,981,448 (GRCm39)	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73,009,361 (GRCm39)	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73,008,947 (GRCm39)	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73,021,777 (GRCm39)	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73,009,331 (GRCm39)	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73,009,029 (GRCm39)	splice site	probably benign
IGL02859:Itgae	APN	11	73,005,693 (GRCm39)	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73,016,136 (GRCm39)	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73,004,427 (GRCm39)	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73,024,680 (GRCm39)	splice site	probably null
IGL03352:Itgae	APN	11	73,022,556 (GRCm39)	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73,021,825 (GRCm39)	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73,008,973 (GRCm39)	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73,014,009 (GRCm39)	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73,005,733 (GRCm39)	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73,029,335 (GRCm39)	nonsense	probably null
R1231:Itgae	UTSW	11	73,010,205 (GRCm39)	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73,016,188 (GRCm39)	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73,006,418 (GRCm39)	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73,036,431 (GRCm39)	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73,007,988 (GRCm39)	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R1915:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R2061:Itgae	UTSW	11	73,009,448 (GRCm39)	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73,036,395 (GRCm39)	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73,012,763 (GRCm39)	nonsense	probably null
R2886:Itgae	UTSW	11	73,031,513 (GRCm39)	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73,004,442 (GRCm39)	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73,002,165 (GRCm39)	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73,002,960 (GRCm39)	missense	probably benign
R4212:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4213:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4691:Itgae	UTSW	11	73,010,345 (GRCm39)	nonsense	probably null
R4736:Itgae	UTSW	11	73,005,706 (GRCm39)	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73,021,821 (GRCm39)	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73,001,382 (GRCm39)	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73,036,464 (GRCm39)	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73,002,675 (GRCm39)	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73,024,734 (GRCm39)	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73,020,074 (GRCm39)	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73,036,377 (GRCm39)	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73,031,583 (GRCm39)	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73,036,427 (GRCm39)	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73,022,519 (GRCm39)	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73,002,228 (GRCm39)	splice site	probably null
R6502:Itgae	UTSW	11	73,036,418 (GRCm39)	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73,009,322 (GRCm39)	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73,010,342 (GRCm39)	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73,002,195 (GRCm39)	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73,002,184 (GRCm39)	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73,031,504 (GRCm39)	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73,012,786 (GRCm39)	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73,004,457 (GRCm39)	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73,014,095 (GRCm39)	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73,029,618 (GRCm39)	missense	probably benign
R7860:Itgae	UTSW	11	73,011,099 (GRCm39)	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73,024,913 (GRCm39)	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73,011,210 (GRCm39)	missense	probably benign
R8911:Itgae	UTSW	11	73,004,447 (GRCm39)	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73,016,089 (GRCm39)	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73,012,752 (GRCm39)	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73,006,906 (GRCm39)	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73,002,629 (GRCm39)	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73,016,182 (GRCm39)	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73,011,171 (GRCm39)	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73,002,202 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1186:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1186:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1187:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1188:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1189:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1190:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1191:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1192:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- GTGCTCTTACAATGTGGAGCAG -3'
(R):5'- TGGATAGGATACACAGTCTCCAC -3'

Sequencing Primer
(F):5'- TGTGTGATGCAAATCCGCC -3'
(R):5'- AGTCTCCACTGGGCTGCTC -3'

Posted On

2014-12-04