Incidental Mutation 'R2497:Enam'
ID 251043
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Name enamelin
Synonyms abte
MMRRC Submission 040411-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R2497 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 88635834-88653908 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88650553 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 687 (N687K)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
AlphaFold O55196
Predicted Effect probably benign
Transcript: ENSMUST00000031222
AA Change: N612K

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: N612K

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199104
AA Change: N687K

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: N687K

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 A G 14: 8,251,612 (GRCm38) V295A probably benign Het
Agrn T C 4: 156,258,268 (GRCm39) E959G probably benign Het
Aqp5 T C 15: 99,489,180 (GRCm39) F10L possibly damaging Het
Arhgap39 C A 15: 76,609,585 (GRCm39) V1025L probably damaging Het
Atg4d C T 9: 21,184,682 (GRCm39) R459* probably null Het
Atp11b A G 3: 35,909,294 (GRCm39) S1163G probably damaging Het
Atp13a5 G T 16: 29,157,889 (GRCm39) S173* probably null Het
Atp6v1g2 T A 17: 35,455,762 (GRCm39) I8N probably damaging Het
Ccdc77 C T 6: 120,302,433 (GRCm39) G430R possibly damaging Het
Cdc34b A G 11: 94,633,207 (GRCm39) T136A probably benign Het
Cdkal1 A G 13: 29,658,524 (GRCm39) S23P unknown Het
Cdkl2 T A 5: 92,156,857 (GRCm39) H566L probably benign Het
Cers6 T C 2: 68,901,790 (GRCm39) probably benign Het
Cfap251 T C 5: 123,421,432 (GRCm39) V98A probably damaging Het
Clspn A G 4: 126,466,140 (GRCm39) T557A possibly damaging Het
Cmya5 T C 13: 93,234,513 (GRCm39) T192A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Dnah17 T G 11: 117,977,850 (GRCm39) probably null Het
Dnah8 C T 17: 30,960,339 (GRCm39) Q2239* probably null Het
Dscaml1 T C 9: 45,656,376 (GRCm39) V1572A probably benign Het
Elfn2 C G 15: 78,558,464 (GRCm39) E28Q probably damaging Het
Flywch1 G A 17: 23,974,685 (GRCm39) R652W probably benign Het
Gm5612 T C 9: 18,338,975 (GRCm39) probably benign Het
Hgsnat C T 8: 26,435,280 (GRCm39) W618* probably null Het
Mmp3 A G 9: 7,450,131 (GRCm39) T288A probably benign Het
Mtmr4 T A 11: 87,491,649 (GRCm39) F168L probably damaging Het
Mtres1 T C 10: 43,401,263 (GRCm39) probably benign Het
Myo1d T A 11: 80,565,647 (GRCm39) N393Y probably damaging Het
Nacc2 A T 2: 25,979,580 (GRCm39) Y285* probably null Het
Nf1 G T 11: 79,334,710 (GRCm39) G844V probably damaging Het
Nox4 T A 7: 86,945,084 (GRCm39) Y113* probably null Het
Pcdha3 T C 18: 37,080,556 (GRCm39) C433R probably benign Het
Pde6c A G 19: 38,142,142 (GRCm39) I358V probably damaging Het
Pdgfrb A T 18: 61,211,700 (GRCm39) D819V possibly damaging Het
Phf3 C A 1: 30,869,095 (GRCm39) R651L probably damaging Het
Prrx1 A G 1: 163,075,834 (GRCm39) V244A possibly damaging Het
Ptges C T 2: 30,782,722 (GRCm39) G110D possibly damaging Het
Rab27a T C 9: 72,992,263 (GRCm39) L97P probably damaging Het
Rnf20 G A 4: 49,652,676 (GRCm39) probably null Het
Sdad1 T C 5: 92,447,958 (GRCm39) N259S probably benign Het
Serpinb9d T C 13: 33,380,500 (GRCm39) S129P probably damaging Het
Slc1a4 T C 11: 20,282,620 (GRCm39) probably benign Het
Smyd2 T A 1: 189,617,534 (GRCm39) N300I possibly damaging Het
Snd1 A G 6: 28,888,078 (GRCm39) I875V probably benign Het
Ssh1 T C 5: 114,096,919 (GRCm39) N174S probably damaging Het
Stimate C T 14: 30,594,537 (GRCm39) L217F probably damaging Het
Tanc2 T C 11: 105,564,319 (GRCm39) probably null Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Tpcn1 C T 5: 120,677,063 (GRCm39) probably null Het
Unc45b A T 11: 82,827,269 (GRCm39) I699F probably damaging Het
Uspl1 C T 5: 149,124,664 (GRCm39) P27L probably damaging Het
Ylpm1 C G 12: 85,043,535 (GRCm39) P91R probably damaging Het
Zdhhc23 G A 16: 43,794,278 (GRCm39) T132M probably damaging Het
Zfp148 T C 16: 33,316,755 (GRCm39) Y434H probably damaging Het
Zhx2 T C 15: 57,686,551 (GRCm39) V640A possibly damaging Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88,649,343 (GRCm39) missense possibly damaging 0.83
IGL01611:Enam APN 5 88,651,608 (GRCm39) missense probably damaging 0.99
IGL01802:Enam APN 5 88,651,533 (GRCm39) missense possibly damaging 0.93
IGL02220:Enam APN 5 88,652,418 (GRCm39) nonsense probably null
IGL02371:Enam APN 5 88,650,668 (GRCm39) missense probably benign 0.39
IGL02596:Enam APN 5 88,650,885 (GRCm39) missense probably benign 0.01
IGL03026:Enam APN 5 88,651,158 (GRCm39) missense probably benign 0.38
IGL03303:Enam APN 5 88,652,450 (GRCm39) missense probably benign 0.12
opinionated UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
recalcitrant UTSW 5 88,651,650 (GRCm39) nonsense probably null
R0200:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0230:Enam UTSW 5 88,637,514 (GRCm39) splice site probably benign
R0395:Enam UTSW 5 88,649,367 (GRCm39) missense probably damaging 0.99
R0548:Enam UTSW 5 88,650,964 (GRCm39) missense probably damaging 0.96
R0608:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0724:Enam UTSW 5 88,649,853 (GRCm39) missense probably damaging 1.00
R0927:Enam UTSW 5 88,641,919 (GRCm39) missense possibly damaging 0.72
R1023:Enam UTSW 5 88,649,826 (GRCm39) missense probably damaging 0.99
R1053:Enam UTSW 5 88,651,878 (GRCm39) missense possibly damaging 0.64
R1169:Enam UTSW 5 88,651,117 (GRCm39) missense probably damaging 1.00
R1230:Enam UTSW 5 88,641,927 (GRCm39) missense probably damaging 0.99
R1324:Enam UTSW 5 88,641,927 (GRCm39) missense possibly damaging 0.53
R1663:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1727:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1750:Enam UTSW 5 88,651,086 (GRCm39) missense probably damaging 1.00
R1852:Enam UTSW 5 88,652,324 (GRCm39) missense possibly damaging 0.92
R1907:Enam UTSW 5 88,652,481 (GRCm39) missense possibly damaging 0.86
R2104:Enam UTSW 5 88,649,646 (GRCm39) missense probably damaging 1.00
R2143:Enam UTSW 5 88,640,779 (GRCm39) missense probably benign 0.02
R2196:Enam UTSW 5 88,650,603 (GRCm39) missense probably damaging 0.99
R2363:Enam UTSW 5 88,651,008 (GRCm39) missense probably benign 0.24
R3615:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3616:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3782:Enam UTSW 5 88,650,674 (GRCm39) missense probably damaging 1.00
R4067:Enam UTSW 5 88,651,236 (GRCm39) missense probably damaging 1.00
R4349:Enam UTSW 5 88,651,407 (GRCm39) missense probably damaging 0.99
R4604:Enam UTSW 5 88,652,142 (GRCm39) missense possibly damaging 0.93
R4649:Enam UTSW 5 88,640,827 (GRCm39) missense probably benign 0.02
R4702:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4703:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4704:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4705:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4714:Enam UTSW 5 88,651,395 (GRCm39) missense probably damaging 1.00
R4748:Enam UTSW 5 88,649,402 (GRCm39) missense probably damaging 1.00
R4838:Enam UTSW 5 88,640,967 (GRCm39) nonsense probably null
R4840:Enam UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
R4856:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4886:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4910:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R4911:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R6103:Enam UTSW 5 88,650,187 (GRCm39) missense probably damaging 0.96
R6651:Enam UTSW 5 88,650,776 (GRCm39) missense probably damaging 0.98
R6759:Enam UTSW 5 88,649,550 (GRCm39) missense probably damaging 1.00
R7282:Enam UTSW 5 88,650,186 (GRCm39) missense probably damaging 0.99
R7365:Enam UTSW 5 88,649,347 (GRCm39) missense possibly damaging 0.75
R7392:Enam UTSW 5 88,649,523 (GRCm39) missense probably damaging 0.99
R7483:Enam UTSW 5 88,649,679 (GRCm39) missense probably damaging 1.00
R7647:Enam UTSW 5 88,650,884 (GRCm39) missense probably benign 0.00
R7648:Enam UTSW 5 88,652,016 (GRCm39) missense possibly damaging 0.89
R7672:Enam UTSW 5 88,651,830 (GRCm39) missense possibly damaging 0.80
R7943:Enam UTSW 5 88,636,410 (GRCm39) splice site probably null
R7999:Enam UTSW 5 88,651,561 (GRCm39) missense probably benign
R8117:Enam UTSW 5 88,651,385 (GRCm39) missense probably benign 0.00
R8419:Enam UTSW 5 88,651,209 (GRCm39) missense possibly damaging 0.80
R8528:Enam UTSW 5 88,650,078 (GRCm39) missense probably damaging 0.98
R8836:Enam UTSW 5 88,639,124 (GRCm39) critical splice donor site probably null
R8973:Enam UTSW 5 88,641,947 (GRCm39) missense possibly damaging 0.96
R9001:Enam UTSW 5 88,637,388 (GRCm39) missense probably benign 0.11
R9033:Enam UTSW 5 88,646,475 (GRCm39) missense probably benign 0.01
R9268:Enam UTSW 5 88,640,778 (GRCm39) missense probably benign 0.01
R9723:Enam UTSW 5 88,652,241 (GRCm39) missense probably damaging 1.00
X0018:Enam UTSW 5 88,650,550 (GRCm39) nonsense probably null
Z1176:Enam UTSW 5 88,640,830 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAGAAGCAATCAGGCCTC -3'
(R):5'- GGTGTGTACCATGTTTTAACTCAGG -3'

Sequencing Primer
(F):5'- AAATAAACCATTTGTGGGCACC -3'
(R):5'- AGTTTCTGATTGAAATGGGGTTCTTC -3'
Posted On 2014-12-04