Incidental Mutation 'R2696:Atp8b3'
ID251085
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 040434-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R2696 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80534183 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 132 (Q132L)
Ref Sequence ENSEMBL: ENSMUSP00000151571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000219648] [ENSMUST00000220326]
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: Q132L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: Q132L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219648
Predicted Effect possibly damaging
Transcript: ENSMUST00000220326
AA Change: Q132L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,850,364 T540S probably benign Het
Acp7 G T 7: 28,614,576 H369Q probably benign Het
Adgrg3 A G 8: 95,021,074 N65S probably benign Het
Anln A G 9: 22,360,963 V620A probably benign Het
Atp10a T A 7: 58,813,618 S966R probably benign Het
Col4a1 T A 8: 11,235,092 probably null Het
Ddx21 T C 10: 62,594,092 H291R possibly damaging Het
Dlgap3 A G 4: 127,194,623 Y4C probably damaging Het
Dnah5 A G 15: 28,278,576 N1106D probably benign Het
Esyt1 T C 10: 128,517,045 D662G probably damaging Het
F830016B08Rik T A 18: 60,300,736 V297E possibly damaging Het
Faf1 T A 4: 109,841,328 N328K possibly damaging Het
Gdf3 A C 6: 122,606,900 F169L probably benign Het
Ifi213 G A 1: 173,590,024 T274I probably benign Het
Igf2r T C 17: 12,695,344 D1746G possibly damaging Het
Ighv1-75 T C 12: 115,834,206 K32R probably benign Het
Ipo8 T A 6: 148,796,741 Q594L probably benign Het
Krt83 A T 15: 101,487,009 I402N probably benign Het
Med18 G A 4: 132,459,970 R118W probably damaging Het
Mmrn2 A G 14: 34,398,415 E414G probably damaging Het
Myo6 A G 9: 80,260,894 T447A probably benign Het
Ncoa6 T C 2: 155,438,015 E27G probably benign Het
Ngly1 T C 14: 16,283,439 L406S possibly damaging Het
Olfr125 T C 17: 37,835,107 I36T probably benign Het
Olfr630 A G 7: 103,755,528 I19T probably damaging Het
Phldb1 T C 9: 44,718,288 Y156C probably damaging Het
Pkd2l1 T A 19: 44,157,269 T172S probably benign Het
Pknox2 G A 9: 36,909,691 R292* probably null Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Polr3e T C 7: 120,933,377 L212P probably damaging Het
Ppp4r4 A G 12: 103,581,394 I215M possibly damaging Het
Psmg2 T C 18: 67,648,218 Y127H possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptp4a1 A T 1: 30,946,132 M4K probably benign Het
R3hcc1l A T 19: 42,563,988 I475L possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rsf1 GGC GGCGGCGGCGGC 7: 97,579,933 probably benign Het
Sec63 T A 10: 42,783,526 I70N probably benign Het
Slc2a5 A C 4: 150,120,746 K4T probably benign Het
Slc4a3 A G 1: 75,555,475 Y939C possibly damaging Het
Slc7a15 T C 12: 8,529,345 *229W probably null Het
Slco1a6 C A 6: 142,112,936 G206C probably damaging Het
Spata9 A G 13: 75,977,776 Q126R probably benign Het
Speg A T 1: 75,406,926 D1186V probably benign Het
Spink5 T G 18: 43,982,292 M197R probably damaging Het
Stab2 T C 10: 86,861,499 D1975G probably benign Het
Syngap1 T A 17: 26,957,411 C224* probably null Het
Ttn T C 2: 76,868,463 probably benign Het
Txnrd1 G A 10: 82,885,282 E397K probably benign Het
Ugt2b36 A T 5: 87,089,485 M313K probably damaging Het
Ulk3 A G 9: 57,590,441 I74V possibly damaging Het
Zcchc4 T C 5: 52,796,231 V194A probably damaging Het
Zfp27 C T 7: 29,896,367 A58T possibly damaging Het
Zfp398 T G 6: 47,866,945 *512E probably null Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CAGACTCAGCTGGGATGTAC -3'
(R):5'- CACTCGTGATCTTGTGGATGAC -3'

Sequencing Primer
(F):5'- CTCAACTGAGAGGTCGACTC -3'
(R):5'- TGTCCACACAGGGAGCAG -3'
Posted On2014-12-04