Incidental Mutation 'R0310:Epha7'
ID25112
Institutional Source Beutler Lab
Gene Symbol Epha7
Ensembl Gene ENSMUSG00000028289
Gene NameEph receptor A7
SynonymsEhk3, Hek11, Cek11, MDK1, Ebk, Mdk1
MMRRC Submission 038520-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R0310 (G1)
Quality Score206
Status Validated
Chromosome4
Chromosomal Location28813131-28967499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28961301 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 845 (I845V)
Ref Sequence ENSEMBL: ENSMUSP00000103826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000108191] [ENSMUST00000108194]
Predicted Effect probably benign
Transcript: ENSMUST00000029964
AA Change: I849V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289
AA Change: I849V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 557 630 4.4e-25 PFAM
TyrKc 633 890 8.84e-139 SMART
SAM 920 987 1.26e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108191
AA Change: I845V

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289
AA Change: I845V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 556 626 2.9e-23 PFAM
TyrKc 629 886 8.84e-139 SMART
SAM 916 983 1.26e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108194
SMART Domains Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
transmembrane domain 556 578 N/A INTRINSIC
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.3%
  • 20x: 82.5%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,425,671 T92P probably damaging Het
9530053A07Rik G T 7: 28,142,274 V545L probably benign Het
Abca13 T C 11: 9,293,810 V1891A probably benign Het
Abcc1 T A 16: 14,410,927 I346N probably damaging Het
Afdn G T 17: 13,885,508 probably null Het
Ahrr G A 13: 74,283,024 probably benign Het
Akap13 A G 7: 75,614,930 D507G probably damaging Het
Akap8 A T 17: 32,316,260 M260K possibly damaging Het
Akr1b8 T C 6: 34,365,259 V265A probably benign Het
Alpk3 C G 7: 81,078,610 P496R possibly damaging Het
Ankrd13b A G 11: 77,472,745 V249A possibly damaging Het
Arid4a T C 12: 71,075,830 V995A probably benign Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atad2 G A 15: 58,114,257 A499V probably damaging Het
Barhl2 G T 5: 106,457,387 A152E possibly damaging Het
Bbs12 T A 3: 37,321,045 D547E probably damaging Het
Btaf1 A G 19: 37,004,534 M1655V probably damaging Het
Ccdc50 T A 16: 27,406,658 H40Q probably damaging Het
Ccr9 A T 9: 123,774,552 probably benign Het
Cdh15 A G 8: 122,865,436 D654G probably damaging Het
Cebpz T C 17: 78,926,124 D758G probably damaging Het
Cgn C T 3: 94,765,653 R906K possibly damaging Het
Chil3 T A 3: 106,160,523 M109L possibly damaging Het
Cntnap4 A T 8: 112,842,516 probably null Het
Cyp4f18 C T 8: 72,001,012 probably benign Het
Daam2 A G 17: 49,463,924 probably null Het
Ddost T A 4: 138,310,611 H220Q probably benign Het
Dennd2a C T 6: 39,464,201 probably benign Het
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dnah5 A T 15: 28,299,110 R1539S probably benign Het
Dusp22 T C 13: 30,705,658 I74T probably damaging Het
Dyx1c1 A T 9: 72,972,336 D386V probably damaging Het
E130309D02Rik G T 5: 143,307,888 T278K probably benign Het
Epc1 A G 18: 6,440,202 probably benign Het
Fanci C T 7: 79,407,417 probably benign Het
Fbn1 T A 2: 125,363,644 E1104V probably damaging Het
Fbxo8 T A 8: 56,590,097 F205L probably damaging Het
Fetub T C 16: 22,929,756 probably benign Het
Frs3 T C 17: 47,703,822 V480A probably benign Het
Gne C A 4: 44,060,157 E79* probably null Het
Hrc T A 7: 45,336,497 H357Q probably benign Het
Idh1 T C 1: 65,161,920 M291V probably damaging Het
Iltifb T A 10: 118,293,185 H133L probably benign Het
Ino80b T C 6: 83,124,091 E165G probably damaging Het
Inppl1 A T 7: 101,828,499 probably benign Het
Ip6k2 T C 9: 108,799,233 probably benign Het
Itga11 A T 9: 62,760,346 I654F probably damaging Het
Jag2 G T 12: 112,913,377 probably benign Het
Katna1 G T 10: 7,743,749 probably benign Het
Kcnh4 G T 11: 100,746,169 S707Y probably benign Het
Kcnn2 T G 18: 45,560,518 L387R probably damaging Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Lama5 G T 2: 180,181,566 probably benign Het
Lmbr1l A T 15: 98,908,773 probably benign Het
Mast4 A T 13: 102,754,161 S870T possibly damaging Het
Med1 A G 11: 98,167,574 Y266H probably benign Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mgam T C 6: 40,761,035 probably benign Het
Mmp8 A G 9: 7,561,454 Q153R probably benign Het
Mpeg1 C A 19: 12,461,691 T171N probably benign Het
Mtus2 T C 5: 148,107,019 S806P probably benign Het
Naip2 T A 13: 100,148,842 E1226V probably damaging Het
Naip6 A G 13: 100,308,213 F246L possibly damaging Het
Nav3 T C 10: 109,767,128 I1187V possibly damaging Het
Nbeal1 T C 1: 60,305,370 probably benign Het
Nbeal2 C A 9: 110,638,163 V653L probably damaging Het
Ndufa9 G T 6: 126,827,532 probably benign Het
Nlrp5 G T 7: 23,430,157 C883F probably damaging Het
Nr0b2 C A 4: 133,555,992 probably null Het
Olfr24 T A 9: 18,755,333 M101L possibly damaging Het
Olfr799 T A 10: 129,647,731 V201E probably damaging Het
Olfr822 G A 10: 130,074,823 V138I probably benign Het
Olfr888 T A 9: 38,109,486 S267T possibly damaging Het
Pkhd1 A T 1: 20,549,822 probably null Het
Pkhd1l1 A G 15: 44,522,738 probably benign Het
Ppm1l A G 3: 69,549,461 K237R probably benign Het
Ppp1r18 T C 17: 35,873,711 probably benign Het
Ptpn3 A T 4: 57,204,958 D734E probably benign Het
Pxdn T C 12: 30,015,529 C1283R probably damaging Het
Rbm12 A G 2: 156,095,724 probably benign Het
Rttn A T 18: 89,009,460 probably benign Het
Sgsm1 G T 5: 113,263,705 H431Q probably benign Het
Siah3 A G 14: 75,525,927 N206S possibly damaging Het
Slc22a15 G T 3: 101,860,511 D521E probably benign Het
Sprr2k A T 3: 92,433,463 probably benign Het
Stab2 G A 10: 86,967,613 probably benign Het
Sval3 T A 6: 41,968,186 L16Q probably damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Tk1 T C 11: 117,817,095 probably benign Het
Tlk2 C A 11: 105,254,973 A335E probably benign Het
Tmtc1 T C 6: 148,249,581 K659E probably benign Het
Tnk2 C T 16: 32,680,590 P907L probably benign Het
Trim14 C A 4: 46,522,043 K211N probably damaging Het
Trim15 A C 17: 36,866,986 L39R probably damaging Het
Tspan15 T A 10: 62,188,093 T269S probably benign Het
Ttc7 T A 17: 87,361,864 D646E probably benign Het
Ttll6 A T 11: 96,147,556 Q410L probably benign Het
Unc79 A G 12: 103,061,407 Q419R probably damaging Het
Vcam1 A T 3: 116,114,416 Y666N possibly damaging Het
Vmn1r10 A T 6: 57,113,501 Y26F probably damaging Het
Vmn1r80 A G 7: 12,193,848 N295S probably benign Het
Vmn2r114 A T 17: 23,290,943 H854Q probably benign Het
Vmn2r2 A T 3: 64,134,618 D225E probably damaging Het
Vmn2r4 A T 3: 64,389,434 Y643* probably null Het
Vmn2r52 T A 7: 10,159,466 Y582F probably damaging Het
Vmn2r60 G T 7: 42,195,140 L642F possibly damaging Het
Zbtb20 T C 16: 43,609,746 S207P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zkscan7 G T 9: 122,888,893 E118* probably null Het
Other mutations in Epha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Epha7 APN 4 28961285 intron probably benign
IGL00849:Epha7 APN 4 28870662 missense possibly damaging 0.63
IGL00898:Epha7 APN 4 28938693 missense probably damaging 1.00
IGL02036:Epha7 APN 4 28950509 missense probably damaging 1.00
IGL02227:Epha7 APN 4 28821587 missense possibly damaging 0.85
IGL02237:Epha7 APN 4 28949325 splice site probably null
IGL02376:Epha7 APN 4 28951287 missense probably damaging 1.00
IGL02424:Epha7 APN 4 28948790 intron probably benign
IGL02519:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02522:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02524:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02602:Epha7 APN 4 28871877 missense possibly damaging 0.88
R0001:Epha7 UTSW 4 28961279 intron probably benign
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0373:Epha7 UTSW 4 28935700 splice site probably null
R0496:Epha7 UTSW 4 28821292 missense probably damaging 1.00
R0554:Epha7 UTSW 4 28951401 missense probably damaging 1.00
R0632:Epha7 UTSW 4 28821104 missense probably damaging 1.00
R1677:Epha7 UTSW 4 28947571 nonsense probably null
R1883:Epha7 UTSW 4 28950362 missense possibly damaging 0.58
R1919:Epha7 UTSW 4 28963969 missense possibly damaging 0.48
R1952:Epha7 UTSW 4 28950474 missense probably damaging 0.97
R1999:Epha7 UTSW 4 28938686 nonsense probably null
R2187:Epha7 UTSW 4 28942648 missense possibly damaging 0.63
R2308:Epha7 UTSW 4 28821503 missense possibly damaging 0.91
R2417:Epha7 UTSW 4 28947579 missense probably damaging 1.00
R3911:Epha7 UTSW 4 28938680 missense probably benign 0.01
R4350:Epha7 UTSW 4 28950393 missense probably damaging 0.98
R4688:Epha7 UTSW 4 28821367 missense probably damaging 1.00
R4702:Epha7 UTSW 4 28961425 missense probably damaging 1.00
R4957:Epha7 UTSW 4 28871892 missense probably damaging 0.99
R5364:Epha7 UTSW 4 28950557 missense probably damaging 1.00
R5661:Epha7 UTSW 4 28946217 intron probably null
R5820:Epha7 UTSW 4 28949365 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6591:Epha7 UTSW 4 28813482 critical splice donor site probably null
R6783:Epha7 UTSW 4 28950528 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTGCCTCCTGGACCCCATAATAAC -3'
(R):5'- CCGAAAGCAATGCCTGTCTACCTG -3'

Sequencing Primer
(F):5'- CATTTTGCCTTCCAAGCAGTTC -3'
(R):5'- GGCACTTTCTGAGAAAGACATC -3'
Posted On2013-04-16