Incidental Mutation 'R2496:Setx'
ID251145
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2496 (G1)
Quality Score220
Status Not validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29144801 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 433 (I433V)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably benign
Transcript: ENSMUST00000061578
AA Change: I433V

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: I433V

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGATCAGCCATTTGTCCAG -3'
(R):5'- TTCTCACAACTCCGGACAAATG -3'

Sequencing Primer
(F):5'- GATCAGCCATTTGTCCAGATTATTG -3'
(R):5'- TAGGAAGCTTGGCACACTTC -3'
Posted On2014-12-04