Incidental Mutation 'R2496:Ptges'
ID251147
Institutional Source Beutler Lab
Gene Symbol Ptges
Ensembl Gene ENSMUSG00000050737
Gene Nameprostaglandin E synthase
Synonyms2410099E23Rik, D2Ertd369e, mPGES, mPGES-1
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30889471-30929863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30892710 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 110 (G110D)
Ref Sequence ENSEMBL: ENSMUSP00000099916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102852]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056046
SMART Domains Protein: ENSMUSP00000054679
Gene: ENSMUSG00000050737

DomainStartEndE-ValueType
Pfam:MAPEG 13 129 9.6e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102852
AA Change: G110D

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099916
Gene: ENSMUSG00000050737
AA Change: G110D

DomainStartEndE-ValueType
Pfam:MAPEG 17 147 1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132244
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glutathione-dependent prostaglandin E synthase. The expression of this gene has been shown to be induced by proinflammatory cytokine interleukin 1 beta (IL1B). Its expression can also be induced by tumor suppressor protein TP53, and may be involved in TP53 induced apoptosis. Knockout studies in mice suggest that this gene may contribute to the pathogenesis of collagen-induced arthritis and mediate acute pain during inflammatory responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and display a decreased inflammatory response. Mice homozygous for a conditional allele activated in the vascular smooth muscle, endothelial or myeloid cells exhibit altered response to vascular injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Ptges
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ptges APN 2 30892708 missense probably damaging 1.00
IGL02737:Ptges APN 2 30892686 missense probably damaging 1.00
R0352:Ptges UTSW 2 30903132 nonsense probably null
R2164:Ptges UTSW 2 30892696 missense probably benign 0.31
R2497:Ptges UTSW 2 30892710 missense possibly damaging 0.89
R4832:Ptges UTSW 2 30903220 utr 5 prime probably benign
R6703:Ptges UTSW 2 30903121 missense possibly damaging 0.80
R7155:Ptges UTSW 2 30892804 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CGCAAGTTCAGCCTTCATGG -3'
(R):5'- TTTCACAGGACTTTGAGCCG -3'

Sequencing Primer
(F):5'- GCTCTGTCCCCACTGTGGTAG -3'
(R):5'- TGGCTGTCCCAGAAGGTTC -3'
Posted On2014-12-04