Incidental Mutation 'R2496:Mylk2'
ID251156
Institutional Source Beutler Lab
Gene Symbol Mylk2
Ensembl Gene ENSMUSG00000027470
Gene Namemyosin, light polypeptide kinase 2, skeletal muscle
Synonyms
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152911352-152923068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152913668 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 251 (P251S)
Ref Sequence ENSEMBL: ENSMUSP00000028970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028970]
Predicted Effect probably damaging
Transcript: ENSMUST00000028970
AA Change: P251S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028970
Gene: ENSMUSG00000027470
AA Change: P251S

DomainStartEndE-ValueType
low complexity region 90 122 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 278 285 N/A INTRINSIC
S_TKc 302 557 6.08e-87 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myosin light chain kinase, a calcium/calmodulin dependent enzyme, that is exclusively expressed in adult skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout mice display impaired skeletal muscle twitch tension response to tetanic stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Mylk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Mylk2 APN 2 152915214 missense probably benign 0.20
IGL02097:Mylk2 APN 2 152915136 missense probably damaging 0.98
IGL02158:Mylk2 APN 2 152919157 missense probably damaging 1.00
IGL02189:Mylk2 APN 2 152915154 missense probably damaging 1.00
IGL02243:Mylk2 APN 2 152920553 missense probably damaging 1.00
IGL02716:Mylk2 APN 2 152922153 makesense probably null
IGL02946:Mylk2 APN 2 152919210 nonsense probably null
IGL03105:Mylk2 APN 2 152917359 missense possibly damaging 0.94
R1184:Mylk2 UTSW 2 152913741 critical splice donor site probably null
R1443:Mylk2 UTSW 2 152919416 missense probably damaging 1.00
R1957:Mylk2 UTSW 2 152917607 missense possibly damaging 0.86
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R3081:Mylk2 UTSW 2 152919354 missense probably benign 0.31
R4510:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4511:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4600:Mylk2 UTSW 2 152917556 missense probably damaging 1.00
R4633:Mylk2 UTSW 2 152917415 missense probably benign 0.00
R4890:Mylk2 UTSW 2 152920354 missense possibly damaging 0.88
R5267:Mylk2 UTSW 2 152913549 missense probably benign
R5430:Mylk2 UTSW 2 152917548 missense probably damaging 1.00
R5447:Mylk2 UTSW 2 152912510 missense probably damaging 0.96
R6167:Mylk2 UTSW 2 152915753 splice site probably null
R6327:Mylk2 UTSW 2 152913693 missense possibly damaging 0.77
R6391:Mylk2 UTSW 2 152917395 missense probably damaging 1.00
R6913:Mylk2 UTSW 2 152913690 missense possibly damaging 0.76
R7066:Mylk2 UTSW 2 152911668 intron probably null
R7092:Mylk2 UTSW 2 152915190 missense probably benign 0.21
R7403:Mylk2 UTSW 2 152917341 missense probably damaging 1.00
R7442:Mylk2 UTSW 2 152911426 start gained probably benign
R7443:Mylk2 UTSW 2 152911426 start gained probably benign
R7453:Mylk2 UTSW 2 152912433 missense probably damaging 1.00
R7477:Mylk2 UTSW 2 152920341 missense probably damaging 1.00
R7529:Mylk2 UTSW 2 152915704 missense not run
Predicted Primers PCR Primer
(F):5'- CGAGACAACAGACCTCGTCTTTAC -3'
(R):5'- CTGTGACATTTGCACCAGGG -3'

Sequencing Primer
(F):5'- AACAGACCTCGTCTTTACAGGGG -3'
(R):5'- ACATTTGCACCAGGGAGCCTAG -3'
Posted On2014-12-04