Incidental Mutation 'R2496:Mdfic'
ID251179
Institutional Source Beutler Lab
Gene Symbol Mdfic
Ensembl Gene ENSMUSG00000041390
Gene NameMyoD family inhibitor domain containing
Synonymsclone 1.5, Kdt1
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location15720661-15802169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15741042 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 45 (H45L)
Ref Sequence ENSEMBL: ENSMUSP00000140800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101663] [ENSMUST00000120512] [ENSMUST00000125326] [ENSMUST00000128849] [ENSMUST00000140516] [ENSMUST00000189359] [ENSMUST00000190255]
Predicted Effect probably benign
Transcript: ENSMUST00000101663
AA Change: H50L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099186
Gene: ENSMUSG00000041390
AA Change: H50L

DomainStartEndE-ValueType
Pfam:MDFI 74 247 7.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120512
AA Change: H50L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113050
Gene: ENSMUSG00000041390
AA Change: H50L

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125326
AA Change: H50L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139704
Gene: ENSMUSG00000041390
AA Change: H50L

DomainStartEndE-ValueType
Pfam:MDFI 74 175 6e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128849
AA Change: H45L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000140516
Predicted Effect probably benign
Transcript: ENSMUST00000189359
AA Change: H50L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140208
Gene: ENSMUSG00000041390
AA Change: H50L

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190255
AA Change: H132L

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140641
Gene: ENSMUSG00000041390
AA Change: H132L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:MDFI 156 329 8.8e-73 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, which in human have been shown to have different subcellular localization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Mdfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mdfic APN 6 15741074 missense possibly damaging 0.95
IGL02184:Mdfic APN 6 15770367 missense possibly damaging 0.76
IGL03104:Mdfic APN 6 15770320 missense probably damaging 1.00
IGL03177:Mdfic APN 6 15770451 missense probably damaging 1.00
R0521:Mdfic UTSW 6 15799756 missense probably benign 0.07
R1549:Mdfic UTSW 6 15799845 missense probably damaging 1.00
R1613:Mdfic UTSW 6 15799590 intron probably null
R3087:Mdfic UTSW 6 15799669 missense probably damaging 1.00
R3623:Mdfic UTSW 6 15770320 missense probably damaging 1.00
R3887:Mdfic UTSW 6 15799711 missense probably damaging 1.00
R4736:Mdfic UTSW 6 15741020 missense possibly damaging 0.79
R5704:Mdfic UTSW 6 15770292 missense probably damaging 1.00
R6187:Mdfic UTSW 6 15721197 utr 5 prime probably benign
R6501:Mdfic UTSW 6 15770517 missense possibly damaging 0.48
R6517:Mdfic UTSW 6 15770325 missense probably damaging 1.00
R6521:Mdfic UTSW 6 15729028 intron probably benign
Predicted Primers PCR Primer
(F):5'- AACCTATGGCAGACTTGGAAGC -3'
(R):5'- ACTTTCAGACTTAGAGATGTGTAGC -3'

Sequencing Primer
(F):5'- GTCATCAGCTACATGGAGAGTTCC -3'
(R):5'- TGTGTAGCAAAATTACTTGGGAAG -3'
Posted On2014-12-04