Incidental Mutation 'R2496:Tax1bp1'
ID251182
Institutional Source Beutler Lab
Gene Symbol Tax1bp1
Ensembl Gene ENSMUSG00000004535
Gene NameTax1 (human T cell leukemia virus type I) binding protein 1
Synonyms1700069J21Rik, 1200003J11Rik, D6Ertd404e, D6Ertd772e, T6BP, TXBP151
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location52713729-52766780 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 52758357 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080723]
Predicted Effect probably null
Transcript: ENSMUST00000080723
SMART Domains Protein: ENSMUSP00000079548
Gene: ENSMUSG00000004535

DomainStartEndE-ValueType
Pfam:CALCOCO1 15 416 2.6e-92 PFAM
coiled coil region 569 620 N/A INTRINSIC
ZnF_C2H2 753 778 7.57e1 SMART
ZnF_C2H2 780 805 3.21e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149586
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HTLV-1 tax1 binding protein. The encoded protein interacts with TNFAIP3, and inhibits TNF-induced apoptosis by mediating the TNFAIP3 anti-apoptotic activity. Degradation of this protein by caspase-3-like family proteins is associated with apoptosis induced by TNF. This protein may also have a role in the inhibition of inflammatory signaling pathways. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Knockout mice are born alive but fail to thrive and develop inflammatory cardiac valvulitis and dermatitis, die prematurely, and are hypersensitive to low doses of TNF and IL-1beta. In contrast, embryos homozygous for a gene trap mutation die at E13.5 from hemorrhaging and/or cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Tax1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Tax1bp1 APN 6 52753366 missense probably benign 0.16
IGL03177:Tax1bp1 APN 6 52736947 missense possibly damaging 0.95
R0836:Tax1bp1 UTSW 6 52741940 splice site probably benign
R1119:Tax1bp1 UTSW 6 52741948 splice site probably benign
R1456:Tax1bp1 UTSW 6 52744244 missense probably benign 0.01
R1465:Tax1bp1 UTSW 6 52727194 splice site probably benign
R1484:Tax1bp1 UTSW 6 52733320 missense probably damaging 0.99
R1661:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1665:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1712:Tax1bp1 UTSW 6 52729326 missense probably damaging 1.00
R1752:Tax1bp1 UTSW 6 52721413 missense probably damaging 1.00
R1913:Tax1bp1 UTSW 6 52765952 missense probably damaging 1.00
R3782:Tax1bp1 UTSW 6 52739548 missense probably damaging 1.00
R3804:Tax1bp1 UTSW 6 52742785 missense probably benign 0.45
R4238:Tax1bp1 UTSW 6 52766051 nonsense probably null
R4303:Tax1bp1 UTSW 6 52727278 missense possibly damaging 0.90
R4665:Tax1bp1 UTSW 6 52737131 missense probably benign 0.00
R4870:Tax1bp1 UTSW 6 52729493 intron probably benign
R5009:Tax1bp1 UTSW 6 52729493 intron probably benign
R5965:Tax1bp1 UTSW 6 52729332 missense probably damaging 1.00
R6313:Tax1bp1 UTSW 6 52744356 critical splice donor site probably null
R6328:Tax1bp1 UTSW 6 52746709 missense probably benign 0.03
R6338:Tax1bp1 UTSW 6 52729376 nonsense probably null
R6886:Tax1bp1 UTSW 6 52733223 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGCAACTGGTTTCATCCAATTC -3'
(R):5'- TTTCTTCCAGGCCAGCAGAC -3'

Sequencing Primer
(F):5'- CAATTCTTCCCCAAATGTTTGTG -3'
(R):5'- TCCTGTAGACAAGGCTGACC -3'
Posted On2014-12-04