Incidental Mutation 'R2697:Gtf3c1'
ID251192
Institutional Source Beutler Lab
Gene Symbol Gtf3c1
Ensembl Gene ENSMUSG00000032777
Gene Namegeneral transcription factor III C 1
Synonyms
MMRRC Submission 040435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2697 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location125640954-125707780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125643954 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1826 (N1826I)
Ref Sequence ENSEMBL: ENSMUSP00000145939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205659] [ENSMUST00000206183]
Predicted Effect probably benign
Transcript: ENSMUST00000055506
AA Change: N1922I

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777
AA Change: N1922I

DomainStartEndE-ValueType
Pfam:B-block_TFIIIC 174 250 5.1e-20 PFAM
low complexity region 344 354 N/A INTRINSIC
low complexity region 474 514 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 725 745 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 1158 1173 N/A INTRINSIC
low complexity region 1359 1372 N/A INTRINSIC
low complexity region 1423 1443 N/A INTRINSIC
low complexity region 1585 1620 N/A INTRINSIC
low complexity region 1895 1915 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205659
AA Change: N1826I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206042
Predicted Effect probably benign
Transcript: ENSMUST00000206183
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,656 S46G unknown Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam7 A T 14: 68,514,783 C417* probably null Het
Adgrl4 A C 3: 151,510,623 Q481P probably damaging Het
Adra2c C A 5: 35,280,698 N271K probably benign Het
Ahctf1 T C 1: 179,752,532 K2035R probably damaging Het
Ano3 T C 2: 110,794,960 T182A possibly damaging Het
Armc3 T C 2: 19,303,935 Y805H probably damaging Het
BC024139 TCCACCACCACCACCACCAC TCCACCACCACCACCAC 15: 76,120,193 probably benign Het
Cabp7 C T 11: 4,738,837 R211H probably damaging Het
Ccdc117 T C 11: 5,534,888 N112S possibly damaging Het
Cep120 C T 18: 53,740,125 D45N probably benign Het
Cpsf1 T C 15: 76,599,329 Y872C probably damaging Het
Cradd A G 10: 95,175,945 L111P probably damaging Het
Crhr2 A G 6: 55,102,830 L155P probably damaging Het
Fam46a T C 9: 85,324,740 D335G possibly damaging Het
Fgd2 A T 17: 29,376,921 T518S probably damaging Het
Gm340 T A 19: 41,584,027 V407E probably benign Het
Gpam C T 19: 55,083,209 E367K probably damaging Het
Kcnq5 T C 1: 21,479,432 E357G probably damaging Het
Krt1 T A 15: 101,846,929 D465V probably damaging Het
Macrod1 T C 19: 7,196,792 V221A probably damaging Het
Mbd1 T C 18: 74,273,617 S144P possibly damaging Het
Mtfmt T C 9: 65,452,021 V326A probably benign Het
Myo1b T C 1: 51,863,358 D71G probably benign Het
Myo1h A G 5: 114,355,213 Y705C probably damaging Het
Nudt9 T C 5: 104,064,993 W311R probably damaging Het
Olfr132 A G 17: 38,131,009 F61S probably damaging Het
Olfr47 A T 6: 43,236,126 I173F probably damaging Het
Olfr743 C T 14: 50,533,781 A123V probably damaging Het
Olfr808 G A 10: 129,767,924 V143I probably benign Het
Osbp2 A T 11: 3,863,407 L154Q probably benign Het
P3h1 A G 4: 119,247,180 T633A probably damaging Het
Polq T G 16: 37,042,153 L616R probably damaging Het
Pon3 A G 6: 5,232,429 L197S possibly damaging Het
Rap1gds1 C T 3: 138,983,721 probably null Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rfng C A 11: 120,784,039 probably benign Het
Rps6ka2 T G 17: 7,300,322 L728R probably benign Het
Slc41a3 C A 6: 90,642,320 N360K possibly damaging Het
Sult1e1 T C 5: 87,578,538 N239S probably damaging Het
Tacr1 T A 6: 82,492,597 I154N probably damaging Het
Tacstd2 T A 6: 67,535,219 H163L probably benign Het
Tiam1 T C 16: 89,793,164 S1382G probably benign Het
Tmem43 A G 6: 91,479,929 E164G possibly damaging Het
U2af2 G A 7: 5,067,546 R78H probably benign Het
Yipf7 T A 5: 69,541,140 D8V possibly damaging Het
Zfp58 G A 13: 67,491,005 H456Y probably damaging Het
Zfp799 G A 17: 32,820,240 R351* probably null Het
Zfyve9 T C 4: 108,695,819 D715G probably damaging Het
Other mutations in Gtf3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gtf3c1 APN 7 125644258 missense probably benign 0.15
IGL00535:Gtf3c1 APN 7 125644153 missense probably benign 0.00
IGL00778:Gtf3c1 APN 7 125667374 missense probably damaging 1.00
IGL00832:Gtf3c1 APN 7 125654460 splice site probably benign
IGL01383:Gtf3c1 APN 7 125699500 missense probably damaging 1.00
IGL01472:Gtf3c1 APN 7 125651054 splice site probably benign
IGL01743:Gtf3c1 APN 7 125663415 missense probably damaging 1.00
IGL01867:Gtf3c1 APN 7 125662376 missense probably benign 0.44
IGL02016:Gtf3c1 APN 7 125668039 missense probably damaging 1.00
IGL02096:Gtf3c1 APN 7 125659112 missense probably damaging 0.98
IGL02121:Gtf3c1 APN 7 125646731 nonsense probably null
IGL02226:Gtf3c1 APN 7 125667990 splice site probably null
IGL02376:Gtf3c1 APN 7 125668996 missense probably benign 0.41
IGL02581:Gtf3c1 APN 7 125646515 missense possibly damaging 0.80
IGL02750:Gtf3c1 APN 7 125676512 missense probably damaging 1.00
IGL03063:Gtf3c1 APN 7 125646503 missense possibly damaging 0.72
IGL03167:Gtf3c1 APN 7 125670580 critical splice acceptor site probably null
Godiva UTSW 7 125645534 missense possibly damaging 0.86
R0052:Gtf3c1 UTSW 7 125667971 intron probably null
R0266:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0378:Gtf3c1 UTSW 7 125647614 nonsense probably null
R0387:Gtf3c1 UTSW 7 125681104 missense probably damaging 1.00
R0426:Gtf3c1 UTSW 7 125663016 nonsense probably null
R0458:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0613:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0634:Gtf3c1 UTSW 7 125657477 unclassified probably benign
R0658:Gtf3c1 UTSW 7 125698962 missense probably damaging 1.00
R0904:Gtf3c1 UTSW 7 125668842 splice site probably benign
R1051:Gtf3c1 UTSW 7 125707649 missense probably damaging 1.00
R1481:Gtf3c1 UTSW 7 125693138 critical splice donor site probably null
R1590:Gtf3c1 UTSW 7 125676661 missense possibly damaging 0.90
R1782:Gtf3c1 UTSW 7 125667074 missense probably damaging 1.00
R1981:Gtf3c1 UTSW 7 125644272 missense possibly damaging 0.96
R2513:Gtf3c1 UTSW 7 125681173 missense probably benign 0.01
R3963:Gtf3c1 UTSW 7 125693225 unclassified probably null
R4125:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4127:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4646:Gtf3c1 UTSW 7 125659094 missense possibly damaging 0.66
R4653:Gtf3c1 UTSW 7 125674100 missense probably benign 0.23
R4668:Gtf3c1 UTSW 7 125667338 missense probably damaging 1.00
R4803:Gtf3c1 UTSW 7 125663540 missense probably damaging 1.00
R5138:Gtf3c1 UTSW 7 125647492 missense probably benign 0.05
R5149:Gtf3c1 UTSW 7 125668037 missense probably damaging 0.99
R5286:Gtf3c1 UTSW 7 125663408 missense possibly damaging 0.79
R5437:Gtf3c1 UTSW 7 125667368 missense probably damaging 1.00
R5493:Gtf3c1 UTSW 7 125670544 missense probably damaging 1.00
R5610:Gtf3c1 UTSW 7 125703945 missense possibly damaging 0.94
R5656:Gtf3c1 UTSW 7 125662654 missense probably benign 0.27
R5754:Gtf3c1 UTSW 7 125644065 missense possibly damaging 0.86
R5969:Gtf3c1 UTSW 7 125645676 missense possibly damaging 0.91
R6009:Gtf3c1 UTSW 7 125647430 missense possibly damaging 0.66
R6223:Gtf3c1 UTSW 7 125676625 missense probably benign 0.01
R6580:Gtf3c1 UTSW 7 125644347 missense probably benign 0.02
R6628:Gtf3c1 UTSW 7 125668074 missense probably benign 0.04
R6774:Gtf3c1 UTSW 7 125641621 missense possibly damaging 0.93
R6781:Gtf3c1 UTSW 7 125659197 nonsense probably null
R6978:Gtf3c1 UTSW 7 125645534 missense possibly damaging 0.86
R7078:Gtf3c1 UTSW 7 125645742 missense possibly damaging 0.95
R7096:Gtf3c1 UTSW 7 125696559 critical splice acceptor site probably null
R7146:Gtf3c1 UTSW 7 125672821 missense possibly damaging 0.48
R7330:Gtf3c1 UTSW 7 125703883 missense probably benign 0.36
R7345:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
R7480:Gtf3c1 UTSW 7 125642541 missense probably benign 0.22
R7490:Gtf3c1 UTSW 7 125647491 missense probably damaging 0.98
R7555:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
X0065:Gtf3c1 UTSW 7 125641690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGTGGAAGGCATGGAGC -3'
(R):5'- CCTGAGACTGATGCTGAGGAAG -3'

Sequencing Primer
(F):5'- CTACTGTGACTAGGTGAAGCC -3'
(R):5'- ACACTACAGGATGTCCGT -3'
Posted On2014-12-04