Incidental Mutation 'R2496:Smyd4'
ID251207
Institutional Source Beutler Lab
Gene Symbol Smyd4
Ensembl Gene ENSMUSG00000018809
Gene NameSET and MYND domain containing 4
SynonymsG430029E23Rik
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75348433-75405705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75391101 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 467 (S467P)
Ref Sequence ENSEMBL: ENSMUSP00000047505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044530]
Predicted Effect probably benign
Transcript: ENSMUST00000044530
AA Change: S467P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000047505
Gene: ENSMUSG00000018809
AA Change: S467P

DomainStartEndE-ValueType
Pfam:TPR_11 65 132 2.4e-10 PFAM
SET 231 576 4.85e-1 SMART
Blast:TPR 694 726 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145888
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit testicular degeneration and atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Smyd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Smyd4 APN 11 75390808 missense probably benign
IGL02372:Smyd4 APN 11 75390285 nonsense probably null
IGL02390:Smyd4 APN 11 75387506 splice site probably null
IGL02492:Smyd4 APN 11 75403426 missense probably benign
IGL02504:Smyd4 APN 11 75390681 missense probably damaging 1.00
IGL02623:Smyd4 APN 11 75390064 splice site probably benign
IGL02661:Smyd4 APN 11 75390941 nonsense probably null
IGL03084:Smyd4 APN 11 75390607 missense probably benign 0.00
PIT4431001:Smyd4 UTSW 11 75403513 missense probably damaging 1.00
R0507:Smyd4 UTSW 11 75399708 missense possibly damaging 0.69
R0834:Smyd4 UTSW 11 75391132 missense possibly damaging 0.94
R1075:Smyd4 UTSW 11 75400338 missense probably damaging 1.00
R1215:Smyd4 UTSW 11 75390295 missense possibly damaging 0.96
R1759:Smyd4 UTSW 11 75382366 missense probably damaging 1.00
R2862:Smyd4 UTSW 11 75390136 missense probably benign 0.12
R4033:Smyd4 UTSW 11 75349754 missense probably benign 0.06
R4655:Smyd4 UTSW 11 75390732 missense probably damaging 1.00
R4775:Smyd4 UTSW 11 75391192 missense probably damaging 1.00
R4801:Smyd4 UTSW 11 75403184 missense probably damaging 1.00
R4802:Smyd4 UTSW 11 75403184 missense probably damaging 1.00
R4963:Smyd4 UTSW 11 75382294 missense probably benign 0.01
R5306:Smyd4 UTSW 11 75402158 missense probably benign 0.00
R5327:Smyd4 UTSW 11 75390939 missense probably damaging 1.00
R5386:Smyd4 UTSW 11 75390156 missense probably damaging 1.00
R5578:Smyd4 UTSW 11 75404776 missense probably benign 0.03
R7038:Smyd4 UTSW 11 75390514 missense probably damaging 1.00
R7271:Smyd4 UTSW 11 75390499 missense possibly damaging 0.90
R7312:Smyd4 UTSW 11 75390256 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTCCTGGATGCAATGTCAATGG -3'
(R):5'- GTCACTGATTTATTTGATGCCAGGC -3'

Sequencing Primer
(F):5'- TGCAATGTCAATGGAAAGTATGG -3'
(R):5'- ATGCCAGGCTTCCTTTATAGTG -3'
Posted On2014-12-04