Incidental Mutation 'R2496:E2f3'
ID251223
Institutional Source Beutler Lab
Gene Symbol E2f3
Ensembl Gene ENSMUSG00000016477
Gene NameE2F transcription factor 3
SynonymsE2F3b, E2f3a
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location29906575-29986063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29911306 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 333 (S333N)
Ref Sequence ENSEMBL: ENSMUSP00000100012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102948] [ENSMUST00000221536] [ENSMUST00000222730]
Predicted Effect probably damaging
Transcript: ENSMUST00000102948
AA Change: S333N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100012
Gene: ENSMUSG00000016477
AA Change: S333N

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
E2F_TDP 170 235 3.53e-35 SMART
Pfam:E2F_CC-MB 251 344 5.1e-38 PFAM
low complexity region 417 430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221536
AA Change: S216N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000222730
AA Change: S210N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lethality prior to adulthood but otherwise appear normal. Mouse embryonic fibroblast cells from mice homozygous for a null allele are defective in cell cycle progression and exhibit reduced proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr543 T C 7: 102,477,147 K241R probably damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in E2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:E2f3 APN 13 29918704 missense probably damaging 1.00
IGL00774:E2f3 APN 13 29918704 missense probably damaging 1.00
IGL02541:E2f3 APN 13 29916844 critical splice donor site probably null
IGL02669:E2f3 APN 13 29916991 missense probably benign 0.00
IGL03119:E2f3 APN 13 29985365 missense probably benign 0.21
hillside UTSW 13 29918669 missense probably damaging 1.00
Slippery UTSW 13 29918585 missense possibly damaging 0.94
R0830:E2f3 UTSW 13 29985560 missense probably benign 0.02
R0948:E2f3 UTSW 13 29985533 missense probably damaging 0.99
R1442:E2f3 UTSW 13 29918669 missense probably damaging 1.00
R1813:E2f3 UTSW 13 29920176 missense probably damaging 0.97
R4715:E2f3 UTSW 13 29911275 missense probably damaging 1.00
R5202:E2f3 UTSW 13 29918636 missense probably damaging 1.00
R5902:E2f3 UTSW 13 29985267 unclassified probably benign
R6796:E2f3 UTSW 13 29918585 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGAAAACCCTTCTCCATGC -3'
(R):5'- GCTAAAGAAGACGTGGACACCC -3'

Sequencing Primer
(F):5'- ATGCCTTCCTTTTTAAACACCGTG -3'
(R):5'- TGAGAATGGCCACAGACTCTC -3'
Posted On2014-12-04