Incidental Mutation 'R2697:Tiam1'
ID251236
Institutional Source Beutler Lab
Gene Symbol Tiam1
Ensembl Gene ENSMUSG00000002489
Gene NameT cell lymphoma invasion and metastasis 1
SynonymsD16Ium10e, D16Ium10
MMRRC Submission 040435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2697 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location89787111-90143769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89793164 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1382 (S1382G)
Ref Sequence ENSEMBL: ENSMUSP00000132137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002588] [ENSMUST00000114122] [ENSMUST00000114124] [ENSMUST00000144691] [ENSMUST00000163370] [ENSMUST00000164263]
Predicted Effect probably benign
Transcript: ENSMUST00000002588
AA Change: S1382G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000002588
Gene: ENSMUSG00000002489
AA Change: S1382G

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114122
SMART Domains Protein: ENSMUSP00000109757
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
PDZ 44 116 1.15e-5 SMART
low complexity region 201 216 N/A INTRINSIC
RhoGEF 232 421 1.42e-63 SMART
PH 450 585 9.58e-2 SMART
low complexity region 633 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114124
SMART Domains Protein: ENSMUSP00000109759
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134021
AA Change: S97G
Predicted Effect probably benign
Transcript: ENSMUST00000144691
AA Change: S37G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136283
Gene: ENSMUSG00000002489
AA Change: S37G

DomainStartEndE-ValueType
Blast:PH 1 52 2e-30 BLAST
SCOP:d1foea2 1 56 2e-30 SMART
PDB:1FOE|G 1 61 5e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000163370
AA Change: S1382G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132137
Gene: ENSMUSG00000002489
AA Change: S1382G

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164263
AA Change: S413G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126020
Gene: ENSMUSG00000002489
AA Change: S413G

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
RhoGEF 75 264 1.42e-63 SMART
PH 293 428 9.58e-2 SMART
low complexity region 476 485 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178095
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele display resistance to chemically-induced tumors, however, tumors that do develop progress to malignancy. Mice homozygous for a gene trap allele display anencephaly, exencephaly and/or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,656 S46G unknown Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam7 A T 14: 68,514,783 C417* probably null Het
Adgrl4 A C 3: 151,510,623 Q481P probably damaging Het
Adra2c C A 5: 35,280,698 N271K probably benign Het
Ahctf1 T C 1: 179,752,532 K2035R probably damaging Het
Ano3 T C 2: 110,794,960 T182A possibly damaging Het
Armc3 T C 2: 19,303,935 Y805H probably damaging Het
BC024139 TCCACCACCACCACCACCAC TCCACCACCACCACCAC 15: 76,120,193 probably benign Het
Cabp7 C T 11: 4,738,837 R211H probably damaging Het
Ccdc117 T C 11: 5,534,888 N112S possibly damaging Het
Cep120 C T 18: 53,740,125 D45N probably benign Het
Cpsf1 T C 15: 76,599,329 Y872C probably damaging Het
Cradd A G 10: 95,175,945 L111P probably damaging Het
Crhr2 A G 6: 55,102,830 L155P probably damaging Het
Fam46a T C 9: 85,324,740 D335G possibly damaging Het
Fgd2 A T 17: 29,376,921 T518S probably damaging Het
Gm340 T A 19: 41,584,027 V407E probably benign Het
Gpam C T 19: 55,083,209 E367K probably damaging Het
Gtf3c1 T A 7: 125,643,954 N1826I probably damaging Het
Kcnq5 T C 1: 21,479,432 E357G probably damaging Het
Krt1 T A 15: 101,846,929 D465V probably damaging Het
Macrod1 T C 19: 7,196,792 V221A probably damaging Het
Mbd1 T C 18: 74,273,617 S144P possibly damaging Het
Mtfmt T C 9: 65,452,021 V326A probably benign Het
Myo1b T C 1: 51,863,358 D71G probably benign Het
Myo1h A G 5: 114,355,213 Y705C probably damaging Het
Nudt9 T C 5: 104,064,993 W311R probably damaging Het
Olfr132 A G 17: 38,131,009 F61S probably damaging Het
Olfr47 A T 6: 43,236,126 I173F probably damaging Het
Olfr743 C T 14: 50,533,781 A123V probably damaging Het
Olfr808 G A 10: 129,767,924 V143I probably benign Het
Osbp2 A T 11: 3,863,407 L154Q probably benign Het
P3h1 A G 4: 119,247,180 T633A probably damaging Het
Polq T G 16: 37,042,153 L616R probably damaging Het
Pon3 A G 6: 5,232,429 L197S possibly damaging Het
Rap1gds1 C T 3: 138,983,721 probably null Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rfng C A 11: 120,784,039 probably benign Het
Rps6ka2 T G 17: 7,300,322 L728R probably benign Het
Slc41a3 C A 6: 90,642,320 N360K possibly damaging Het
Sult1e1 T C 5: 87,578,538 N239S probably damaging Het
Tacr1 T A 6: 82,492,597 I154N probably damaging Het
Tacstd2 T A 6: 67,535,219 H163L probably benign Het
Tmem43 A G 6: 91,479,929 E164G possibly damaging Het
U2af2 G A 7: 5,067,546 R78H probably benign Het
Yipf7 T A 5: 69,541,140 D8V possibly damaging Het
Zfp58 G A 13: 67,491,005 H456Y probably damaging Het
Zfp799 G A 17: 32,820,240 R351* probably null Het
Zfyve9 T C 4: 108,695,819 D715G probably damaging Het
Other mutations in Tiam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tiam1 APN 16 89794739 missense probably damaging 1.00
IGL01356:Tiam1 APN 16 89837788 missense probably damaging 0.99
IGL01583:Tiam1 APN 16 89789280 missense probably damaging 1.00
IGL01626:Tiam1 APN 16 89812968 missense probably damaging 1.00
IGL01802:Tiam1 APN 16 89898372 missense possibly damaging 0.94
IGL01818:Tiam1 APN 16 89867704 missense probably damaging 1.00
IGL02146:Tiam1 APN 16 89849681 missense probably benign 0.20
IGL02329:Tiam1 APN 16 89800036 missense probably benign 0.08
IGL02341:Tiam1 APN 16 89898369 missense probably damaging 1.00
IGL02622:Tiam1 APN 16 89798700 missense possibly damaging 0.59
F5770:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
PIT4515001:Tiam1 UTSW 16 89860242 missense probably damaging 0.99
R0130:Tiam1 UTSW 16 89897754 missense probably benign 0.01
R0143:Tiam1 UTSW 16 89898200 missense probably benign 0.01
R0158:Tiam1 UTSW 16 89793001 critical splice donor site probably benign
R0413:Tiam1 UTSW 16 89809365 splice site probably benign
R0449:Tiam1 UTSW 16 89837827 missense possibly damaging 0.75
R0520:Tiam1 UTSW 16 89817951 splice site probably benign
R0667:Tiam1 UTSW 16 89897984 missense probably damaging 1.00
R0787:Tiam1 UTSW 16 89789561 missense probably damaging 1.00
R1355:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1370:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1534:Tiam1 UTSW 16 89867508 critical splice donor site probably null
R1769:Tiam1 UTSW 16 89860279 missense probably damaging 1.00
R1831:Tiam1 UTSW 16 89860294 missense probably benign 0.01
R1913:Tiam1 UTSW 16 89798694 missense probably damaging 1.00
R2022:Tiam1 UTSW 16 89877187 missense probably benign
R2140:Tiam1 UTSW 16 89849645 splice site probably benign
R2383:Tiam1 UTSW 16 89798684 missense probably benign 0.29
R4118:Tiam1 UTSW 16 89877033 splice site probably null
R4327:Tiam1 UTSW 16 89855891 missense possibly damaging 0.80
R4693:Tiam1 UTSW 16 89843282 missense possibly damaging 0.87
R5104:Tiam1 UTSW 16 89818041 missense probably benign 0.00
R5412:Tiam1 UTSW 16 89884865 missense possibly damaging 0.52
R5426:Tiam1 UTSW 16 89865392 missense possibly damaging 0.58
R5600:Tiam1 UTSW 16 89865365 missense probably damaging 1.00
R5842:Tiam1 UTSW 16 89855999 missense probably benign
R5986:Tiam1 UTSW 16 89789186 missense probably benign 0.31
R6077:Tiam1 UTSW 16 89798030 critical splice donor site probably null
R6419:Tiam1 UTSW 16 89898024 nonsense probably null
R6525:Tiam1 UTSW 16 89858597 critical splice donor site probably null
R6950:Tiam1 UTSW 16 89860204 critical splice donor site probably null
R7127:Tiam1 UTSW 16 89860260 missense probably damaging 1.00
R7197:Tiam1 UTSW 16 89884938 missense probably damaging 1.00
R7249:Tiam1 UTSW 16 89843255 missense probably damaging 1.00
V7582:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCTTGTAGGTCTGAATCC -3'
(R):5'- TAGAGGAGGCTTTGCAAACCG -3'

Sequencing Primer
(F):5'- TGTAGGTCTGAATCCCCACAG -3'
(R):5'- GGATTGCGTGTTTTACCTCTGCC -3'
Posted On2014-12-04