Incidental Mutation 'R2507:Ikzf2'
ID251258
Institutional Source Beutler Lab
Gene Symbol Ikzf2
Ensembl Gene ENSMUSG00000025997
Gene NameIKAROS family zinc finger 2
SynonymsA730095J18Rik, Zfpn1a2, Helios
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location69531214-69687245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69539288 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 282 (A282V)
Ref Sequence ENSEMBL: ENSMUSP00000140069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027146] [ENSMUST00000187184] [ENSMUST00000188110] [ENSMUST00000190771] [ENSMUST00000190855] [ENSMUST00000191262]
Predicted Effect probably benign
Transcript: ENSMUST00000027146
AA Change: A354V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027146
Gene: ENSMUSG00000025997
AA Change: A354V

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 112 134 7.67e-2 SMART
ZnF_C2H2 140 162 1.72e-4 SMART
ZnF_C2H2 168 190 3.95e-4 SMART
ZnF_C2H2 196 219 3.58e-2 SMART
ZnF_C2H2 471 493 9.46e0 SMART
ZnF_C2H2 499 523 6.13e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187100
Predicted Effect probably benign
Transcript: ENSMUST00000187184
AA Change: A328V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141075
Gene: ENSMUSG00000025997
AA Change: A328V

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 1.72e-4 SMART
ZnF_C2H2 142 164 3.95e-4 SMART
ZnF_C2H2 170 193 3.58e-2 SMART
ZnF_C2H2 445 467 9.46e0 SMART
ZnF_C2H2 473 497 6.13e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188110
AA Change: A282V

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140069
Gene: ENSMUSG00000025997
AA Change: A282V

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 399 421 4e-2 SMART
ZnF_C2H2 427 451 2.6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190771
AA Change: A360V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000139543
Gene: ENSMUSG00000025997
AA Change: A360V

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
ZnF_C2H2 118 140 3.2e-4 SMART
ZnF_C2H2 146 168 7.3e-7 SMART
ZnF_C2H2 174 196 1.6e-6 SMART
ZnF_C2H2 202 225 1.5e-4 SMART
ZnF_C2H2 477 499 4e-2 SMART
ZnF_C2H2 505 529 2.6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190855
AA Change: A280V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140043
Gene: ENSMUSG00000025997
AA Change: A280V

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 170 193 1.5e-4 SMART
ZnF_C2H2 397 419 4e-2 SMART
ZnF_C2H2 425 449 2.6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191262
AA Change: A209V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139530
Gene: ENSMUSG00000025997
AA Change: A209V

DomainStartEndE-ValueType
ZnF_C2H2 51 74 1.5e-4 SMART
ZnF_C2H2 326 348 4e-2 SMART
ZnF_C2H2 354 378 2.6e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit postnatal lethality for unknown reasons. Survivors have decreased body weight. Postnatal lethality has complete penetrance on the C57BL/6 strain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Ikzf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Ikzf2 APN 1 69539322 missense possibly damaging 0.77
IGL01295:Ikzf2 APN 1 69577987 missense probably benign 0.13
IGL01313:Ikzf2 APN 1 69539430 missense probably damaging 0.98
IGL01390:Ikzf2 APN 1 69570642 missense probably damaging 1.00
IGL01862:Ikzf2 APN 1 69538898 missense probably damaging 0.99
Freefall UTSW 1 69539097 nonsense probably null
Wigwam UTSW 1 69577796 nonsense probably null
R1079:Ikzf2 UTSW 1 69539105 missense possibly damaging 0.62
R1368:Ikzf2 UTSW 1 69539315 missense possibly damaging 0.95
R1661:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1665:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1688:Ikzf2 UTSW 1 69542280 missense possibly damaging 0.77
R1726:Ikzf2 UTSW 1 69548688 missense probably damaging 1.00
R1829:Ikzf2 UTSW 1 69542287 missense probably benign 0.34
R1860:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R4457:Ikzf2 UTSW 1 69684188 unclassified probably benign
R5633:Ikzf2 UTSW 1 69539097 nonsense probably null
R5666:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5670:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5836:Ikzf2 UTSW 1 69539387 missense probably damaging 1.00
R5950:Ikzf2 UTSW 1 69683244 missense probably damaging 1.00
R6492:Ikzf2 UTSW 1 69539042 missense probably damaging 1.00
R6758:Ikzf2 UTSW 1 69538900 missense probably damaging 0.97
R6809:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R6946:Ikzf2 UTSW 1 69577796 nonsense probably null
R6959:Ikzf2 UTSW 1 69538770 makesense probably null
R7044:Ikzf2 UTSW 1 69538901 missense possibly damaging 0.93
R7236:Ikzf2 UTSW 1 69539081 missense probably benign 0.00
R7256:Ikzf2 UTSW 1 69578053 intron probably null
R7488:Ikzf2 UTSW 1 69539385 missense probably benign 0.45
X0027:Ikzf2 UTSW 1 69577852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGACTGGCGGTCATCATG -3'
(R):5'- AAAAGCTTATGCGATTCAGCTACC -3'

Sequencing Primer
(F):5'- GGCTACTTTCTGAGTCAGTAGAATC -3'
(R):5'- ATGCGATTCAGCTACCCAGATATTC -3'
Posted On2014-12-04