Incidental Mutation 'R2507:Tpr'
ID251265
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
MMRRC Submission 040413-MU
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 150392944 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006167] [ENSMUST00000094477] [ENSMUST00000097546] [ENSMUST00000097547] [ENSMUST00000111913] [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect probably benign
Transcript: ENSMUST00000006167
SMART Domains Protein: ENSMUSP00000006167
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094477
SMART Domains Protein: ENSMUSP00000092050
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 383 2.8e-120 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097546
SMART Domains Protein: ENSMUSP00000095152
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097547
SMART Domains Protein: ENSMUSP00000095153
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 209 1.2e-57 PFAM
Pfam:ODR4-like 206 354 3.1e-43 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111913
SMART Domains Protein: ENSMUSP00000107544
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 386 7.1e-113 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119161
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124973
AA Change: M1V
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150615
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 intron probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCTACTCCAAACGCGG -3'
(R):5'- TTTCCAGCCCCAGAGACTCTTG -3'

Sequencing Primer
(F):5'- AGCTCTTCTACCCAAGC -3'
(R):5'- GGAAATGTAGTGTATTTCTCACCCGC -3'
Posted On2014-12-04