Incidental Mutation 'R2698:Olfr352'
ID251268
Institutional Source Beutler Lab
Gene Symbol Olfr352
Ensembl Gene ENSMUSG00000053146
Gene Nameolfactory receptor 352
SynonymsGA_x6K02T2NLDC-33564136-33565083, MOR136-10
MMRRC Submission 040436-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2698 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36868460-36872785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36870196 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 210 (I210K)
Ref Sequence ENSEMBL: ENSMUSP00000149568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065416] [ENSMUST00000217325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065416
AA Change: I210K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070758
Gene: ENSMUSG00000053146
AA Change: I210K

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.4e-56 PFAM
Pfam:7TM_GPCR_Srsx 38 308 1.8e-7 PFAM
Pfam:7tm_1 44 293 1.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217325
AA Change: I210K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,434 S59P probably damaging Het
Abcc9 T C 6: 142,633,136 R901G possibly damaging Het
Abhd18 T A 3: 40,930,966 M262K probably benign Het
Ano2 C A 6: 125,712,346 L145I probably benign Het
Ckap5 T C 2: 91,578,081 W874R probably damaging Het
Cox4i1 G T 8: 120,669,363 probably benign Het
Cwc27 A T 13: 104,806,751 N94K probably damaging Het
Dcaf11 T C 14: 55,566,885 S372P probably damaging Het
Dpysl4 A G 7: 139,096,765 N356S probably damaging Het
Dusp8 A G 7: 142,081,964 probably benign Het
Erc2 G A 14: 28,271,705 V894M probably benign Het
Fbxo28 T A 1: 182,317,154 I282F probably benign Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gabra4 T C 5: 71,572,078 H453R probably benign Het
Glrx T A 13: 75,839,946 probably null Het
Gm11541 A T 11: 94,695,615 L102* probably null Het
Gm5113 T A 7: 30,178,725 Y79* probably null Het
Gpr87 T A 3: 59,179,166 N306I probably damaging Het
Hydin T A 8: 110,609,929 Y5113N possibly damaging Het
Iqsec3 C T 6: 121,413,471 probably benign Het
Kbtbd8 C A 6: 95,126,589 Y406* probably null Het
Lamb1 G T 12: 31,298,883 R590L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lnpk T C 2: 74,537,501 E165G probably damaging Het
Lrp4 C T 2: 91,475,212 R276C probably damaging Het
Lrrc7 T A 3: 158,135,391 T1384S probably benign Het
Mia2 T C 12: 59,170,994 probably null Het
Morc2a T C 11: 3,685,400 V797A probably damaging Het
Mrps23 T C 11: 88,205,367 probably benign Het
Muc3 A T 5: 137,146,636 I62K probably damaging Het
Nlrp4g T A 9: 124,349,630 noncoding transcript Het
Nptx1 A T 11: 119,544,843 probably benign Het
Pabpc1l T G 2: 164,044,382 probably null Het
Pdcd6ip A T 9: 113,674,507 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plcxd1 A G 5: 110,102,483 Q230R probably benign Het
Psme4 T A 11: 30,874,282 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptch1 T A 13: 63,542,224 N320Y probably damaging Het
Qars G A 9: 108,508,443 V60I possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rhag T C 17: 40,836,476 S410P probably damaging Het
Rnf213 A G 11: 119,410,144 K297E probably benign Het
Rps6ka4 T C 19: 6,837,352 E294G probably benign Het
Scaf4 T A 16: 90,244,356 I695F unknown Het
Scrn2 T C 11: 97,032,296 probably benign Het
Scx T A 15: 76,458,163 C188S probably damaging Het
Sdk1 G T 5: 142,212,050 V1893L possibly damaging Het
Sema5a C A 15: 32,673,400 Q795K probably damaging Het
Slc24a3 A G 2: 145,613,567 S459G probably benign Het
Smurf1 A G 5: 144,883,562 probably benign Het
Taar4 T C 10: 23,961,430 Y313H probably damaging Het
Tmprss11c A G 5: 86,271,463 F79S probably damaging Het
Tnfaip8l2 T A 3: 95,140,361 I64F possibly damaging Het
Trbv13-1 A G 6: 41,116,438 T102A probably damaging Het
Trpa1 A T 1: 14,905,998 N160K probably damaging Het
Ttc22 A G 4: 106,639,238 Y495C probably benign Het
Usp50 A G 2: 126,778,029 I121T probably damaging Het
Vmn2r117 A G 17: 23,459,911 S780P probably damaging Het
Vmn2r66 A T 7: 84,995,399 V601D probably damaging Het
Wapl G A 14: 34,691,777 A199T probably benign Het
Zfp658 A G 7: 43,573,545 T415A possibly damaging Het
Zfp760 C T 17: 21,720,954 T9I probably damaging Het
Other mutations in Olfr352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Olfr352 APN 2 36870210 missense probably benign 0.01
IGL01538:Olfr352 APN 2 36870520 utr 3 prime probably benign
IGL01716:Olfr352 APN 2 36869667 missense probably benign 0.11
IGL01735:Olfr352 APN 2 36869686 missense possibly damaging 0.95
IGL01998:Olfr352 APN 2 36869646 missense probably benign 0.01
IGL02820:Olfr352 APN 2 36869859 missense probably benign 0.01
IGL03267:Olfr352 APN 2 36870501 missense probably benign 0.00
IGL03306:Olfr352 APN 2 36870525 utr 3 prime probably benign
R0013:Olfr352 UTSW 2 36870160 missense probably damaging 1.00
R0081:Olfr352 UTSW 2 36870010 missense possibly damaging 0.58
R0421:Olfr352 UTSW 2 36869641 missense possibly damaging 0.89
R1613:Olfr352 UTSW 2 36870393 missense possibly damaging 0.91
R1842:Olfr352 UTSW 2 36869589 missense probably damaging 1.00
R4463:Olfr352 UTSW 2 36870193 missense probably benign 0.31
R4993:Olfr352 UTSW 2 36869988 missense probably benign 0.30
R5553:Olfr352 UTSW 2 36870465 missense probably benign 0.00
R5666:Olfr352 UTSW 2 36870389 missense probably benign 0.11
R5934:Olfr352 UTSW 2 36870268 missense probably benign 0.34
R6290:Olfr352 UTSW 2 36870436 missense probably damaging 1.00
R6312:Olfr352 UTSW 2 36870465 missense probably benign 0.02
R7358:Olfr352 UTSW 2 36869878 missense probably benign
X0022:Olfr352 UTSW 2 36870277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCATCATGAGTCAGAGTCTC -3'
(R):5'- GATTCAGCATGGGTGTGACC -3'

Sequencing Primer
(F):5'- CATGAGTCAGAGTCTCTGTGTACTAC -3'
(R):5'- GGTGTGACCATAGTGTACATCAC -3'
Posted On2014-12-04