Incidental Mutation 'R2507:Bub1'
ID251277
Institutional Source Beutler Lab
Gene Symbol Bub1
Ensembl Gene ENSMUSG00000027379
Gene NameBUB1, mitotic checkpoint serine/threonine kinase
SynonymsD2Xrf87, Bub1a
MMRRC Submission 040413-MU
Accession Numbers

Genbank: NM_009772; MGI: 1100510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127801122-127831865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127801423 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1000 (D1000E)
Ref Sequence ENSEMBL: ENSMUSP00000028858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028858]
Predicted Effect probably benign
Transcript: ENSMUST00000028858
AA Change: D1000E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028858
Gene: ENSMUSG00000027379
AA Change: D1000E

DomainStartEndE-ValueType
Mad3_BUB1_I 4 126 7.41e-46 SMART
low complexity region 216 225 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Pfam:Pkinase_Tyr 762 1011 9.3e-10 PFAM
Pfam:Pkinase 762 1037 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138624
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that play a central role in mitosis. The encoded protein functions in part by phosphorylating members of the mitotic checkpoint complex and activating the spindle checkpoint. This protein also plays a role in inhibiting the activation of the anaphase promoting complex/cyclosome. This protein may also function in the DNA damage response. Mutations in this gene have been associated with aneuploidy and several forms of cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality prior to implantation. Mice homozygous for a kinase dead allele exhibit aneuploidy in somatic and germ cells and reduced male fertility. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(3) Targeted, other(4) Gene trapped(15)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Bub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Bub1 APN 2 127829472 missense probably damaging 0.96
IGL00795:Bub1 APN 2 127821815 missense probably benign 0.00
IGL00966:Bub1 APN 2 127810663 missense probably damaging 1.00
IGL01807:Bub1 APN 2 127812977 missense probably benign 0.00
IGL02212:Bub1 APN 2 127805351 missense probably damaging 1.00
IGL02537:Bub1 APN 2 127801347 nonsense probably null
IGL02935:Bub1 APN 2 127801295 missense probably damaging 1.00
IGL03064:Bub1 APN 2 127817453 missense probably benign 0.00
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0325:Bub1 UTSW 2 127801394 nonsense probably null
R1502:Bub1 UTSW 2 127827419 missense probably damaging 0.98
R1627:Bub1 UTSW 2 127809013 missense probably benign 0.01
R1743:Bub1 UTSW 2 127813850 missense probably damaging 1.00
R1778:Bub1 UTSW 2 127803122 missense possibly damaging 0.60
R2043:Bub1 UTSW 2 127804220 missense probably damaging 1.00
R2108:Bub1 UTSW 2 127819335 missense probably damaging 0.99
R2165:Bub1 UTSW 2 127801281 missense probably benign 0.01
R2190:Bub1 UTSW 2 127810725 missense probably benign 0.06
R2508:Bub1 UTSW 2 127801423 missense probably benign 0.04
R3836:Bub1 UTSW 2 127814886 missense probably damaging 1.00
R3862:Bub1 UTSW 2 127814756 splice site probably benign
R3904:Bub1 UTSW 2 127821942 missense probably benign 0.08
R4373:Bub1 UTSW 2 127805236 intron probably benign
R4580:Bub1 UTSW 2 127829676 critical splice donor site probably null
R4751:Bub1 UTSW 2 127823938 intron probably benign
R5239:Bub1 UTSW 2 127821696 missense probably damaging 1.00
R5498:Bub1 UTSW 2 127814709 missense possibly damaging 0.59
R5591:Bub1 UTSW 2 127819343 missense probably benign 0.16
R5672:Bub1 UTSW 2 127804880 missense possibly damaging 0.70
R5907:Bub1 UTSW 2 127819222 missense probably benign 0.02
R6714:Bub1 UTSW 2 127814732 missense probably benign 0.08
R6781:Bub1 UTSW 2 127807857 missense probably damaging 0.99
R6931:Bub1 UTSW 2 127801382 missense probably damaging 1.00
R7057:Bub1 UTSW 2 127829527 missense probably benign
R7094:Bub1 UTSW 2 127821761 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- AGGTCACATGGGTATATCATATGG -3'
(R):5'- GCTATCTGGCCAATCTTGTCAC -3'

Sequencing Primer
(F):5'- ACTAAGTGTGTTTTGGAGAAGGTC -3'
(R):5'- GGCCAATCTTGTCACATATGTATGC -3'
Posted On2014-12-04