Incidental Mutation 'R2507:Olfr1328'
ID251302
Institutional Source Beutler Lab
Gene Symbol Olfr1328
Ensembl Gene ENSMUSG00000111259
Gene Nameolfactory receptor 1328
SynonymsOlfr1519, MOR259-1, MOR259-13, MOR259-1, GA_x6K02T2QD9B-18602750-18603691
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118930071-118938612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118933925 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 308 (M308V)
Ref Sequence ENSEMBL: ENSMUSP00000149039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081960] [ENSMUST00000215312]
Predicted Effect probably benign
Transcript: ENSMUST00000081960
AA Change: M306V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080626
Gene: ENSMUSG00000111259
AA Change: M306V

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 36 306 9.1e-8 PFAM
Pfam:7tm_1 42 291 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215312
AA Change: M308V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Olfr1328
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr1328 APN 4 118934161 missense probably damaging 1.00
IGL02685:Olfr1328 APN 4 118933937 missense possibly damaging 0.61
IGL02886:Olfr1328 APN 4 118934830 missense probably benign
IGL02899:Olfr1328 APN 4 118934662 missense probably damaging 1.00
IGL02957:Olfr1328 APN 4 118934119 missense probably damaging 1.00
PIT4453001:Olfr1328 UTSW 4 118934626 missense probably benign
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R1158:Olfr1328 UTSW 4 118934417 missense probably damaging 1.00
R1450:Olfr1328 UTSW 4 118934510 missense probably benign 0.01
R1682:Olfr1328 UTSW 4 118934581 missense probably damaging 1.00
R1978:Olfr1328 UTSW 4 118934184 nonsense probably null
R2363:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2364:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2365:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2912:Olfr1328 UTSW 4 118934701 missense probably benign 0.28
R3937:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4058:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4089:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4090:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4419:Olfr1328 UTSW 4 118934389 missense possibly damaging 0.56
R4717:Olfr1328 UTSW 4 118934429 missense probably benign 0.45
R5570:Olfr1328 UTSW 4 118934066 missense possibly damaging 0.88
R5591:Olfr1328 UTSW 4 118934461 missense probably damaging 1.00
R6149:Olfr1328 UTSW 4 118934431 missense probably damaging 1.00
R7202:Olfr1328 UTSW 4 118934018 missense probably benign
R7214:Olfr1328 UTSW 4 118933949 missense possibly damaging 0.88
R7391:Olfr1328 UTSW 4 118934001 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GTGACACCTGTTAATCAAGTCAG -3'
(R):5'- CGCTGCAAGGCTTTCTCTAC -3'

Sequencing Primer
(F):5'- GTCAGCAACATTGGTTTCACATG -3'
(R):5'- ACCTGACTGTGGTCACATTC -3'
Posted On2014-12-04