Incidental Mutation 'R2507:Galnt11'
ID251303
Institutional Source Beutler Lab
Gene Symbol Galnt11
Ensembl Gene ENSMUSG00000038072
Gene Namepolypeptide N-acetylgalactosaminyltransferase 11
SynonymsA430075I06Rik, E430002F06Rik
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location25221904-25265918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 25247612 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 41 (P41A)
Ref Sequence ENSEMBL: ENSMUSP00000110602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045737] [ENSMUST00000114950] [ENSMUST00000114952] [ENSMUST00000144971]
Predicted Effect probably damaging
Transcript: ENSMUST00000045737
AA Change: P41A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036240
Gene: ENSMUSG00000038072
AA Change: P41A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 386 5.3e-9 PFAM
Pfam:Glycos_transf_2 154 337 3.7e-33 PFAM
Pfam:Glyco_transf_7C 315 383 2.1e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114950
AA Change: P41A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110600
Gene: ENSMUSG00000038072
AA Change: P41A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 385 1.7e-10 PFAM
Pfam:Glycos_transf_2 154 337 4.8e-29 PFAM
Pfam:Glyco_transf_7C 314 383 3.5e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114952
AA Change: P41A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110602
Gene: ENSMUSG00000038072
AA Change: P41A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 385 1.7e-10 PFAM
Pfam:Glycos_transf_2 154 337 4.8e-29 PFAM
Pfam:Glyco_transf_7C 314 383 3.5e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144971
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Galnt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Galnt11 APN 5 25248831 splice site probably benign
IGL01553:Galnt11 APN 5 25247720 missense probably benign 0.13
IGL01748:Galnt11 APN 5 25247515 nonsense probably null
R0021:Galnt11 UTSW 5 25248857 missense probably damaging 1.00
R0021:Galnt11 UTSW 5 25248857 missense probably damaging 1.00
R0666:Galnt11 UTSW 5 25252147 missense possibly damaging 0.89
R0784:Galnt11 UTSW 5 25258909 missense probably damaging 1.00
R1136:Galnt11 UTSW 5 25258945 missense probably damaging 0.98
R1168:Galnt11 UTSW 5 25250246 missense probably damaging 1.00
R1617:Galnt11 UTSW 5 25258893 missense probably damaging 1.00
R2033:Galnt11 UTSW 5 25247538 missense probably damaging 1.00
R2508:Galnt11 UTSW 5 25247612 missense probably damaging 1.00
R4237:Galnt11 UTSW 5 25265260 missense probably benign 0.02
R4944:Galnt11 UTSW 5 25265338 missense probably damaging 1.00
R5653:Galnt11 UTSW 5 25248858 missense probably damaging 1.00
R5917:Galnt11 UTSW 5 25247672 intron probably null
R6489:Galnt11 UTSW 5 25264966 missense probably damaging 0.99
R6696:Galnt11 UTSW 5 25255114 missense probably benign
R6709:Galnt11 UTSW 5 25248853 missense probably damaging 1.00
R6881:Galnt11 UTSW 5 25250099 missense possibly damaging 0.69
R7034:Galnt11 UTSW 5 25258813 missense probably damaging 0.99
R7036:Galnt11 UTSW 5 25258813 missense probably damaging 0.99
X0038:Galnt11 UTSW 5 25257494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGTGAGTGCATTCAGTAGC -3'
(R):5'- CCTAGTTCAGAGGAAGATTTTGAGAG -3'

Sequencing Primer
(F):5'- AGTGTTCTAGGTCTAACATGGCTATC -3'
(R):5'- AGAGGCCTTTATCTGGATCTTCAATG -3'
Posted On2014-12-04