Incidental Mutation 'R2698:Vmn2r66'
ID251325
Institutional Source Beutler Lab
Gene Symbol Vmn2r66
Ensembl Gene ENSMUSG00000094950
Gene Namevomeronasal 2, receptor 66
SynonymsF830104D24Rik
MMRRC Submission 040436-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R2698 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location84994645-85012020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84995399 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 601 (V601D)
Ref Sequence ENSEMBL: ENSMUSP00000122645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124773]
Predicted Effect probably damaging
Transcript: ENSMUST00000124773
AA Change: V601D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: V601D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 5e-31 PFAM
Pfam:NCD3G 507 559 6e-21 PFAM
Pfam:7tm_3 589 827 3.8e-52 PFAM
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,434 S59P probably damaging Het
Abcc9 T C 6: 142,633,136 R901G possibly damaging Het
Abhd18 T A 3: 40,930,966 M262K probably benign Het
Ano2 C A 6: 125,712,346 L145I probably benign Het
Ckap5 T C 2: 91,578,081 W874R probably damaging Het
Cox4i1 G T 8: 120,669,363 probably benign Het
Cwc27 A T 13: 104,806,751 N94K probably damaging Het
Dcaf11 T C 14: 55,566,885 S372P probably damaging Het
Dpysl4 A G 7: 139,096,765 N356S probably damaging Het
Dusp8 A G 7: 142,081,964 probably benign Het
Erc2 G A 14: 28,271,705 V894M probably benign Het
Fbxo28 T A 1: 182,317,154 I282F probably benign Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gabra4 T C 5: 71,572,078 H453R probably benign Het
Glrx T A 13: 75,839,946 probably null Het
Gm11541 A T 11: 94,695,615 L102* probably null Het
Gm5113 T A 7: 30,178,725 Y79* probably null Het
Gpr87 T A 3: 59,179,166 N306I probably damaging Het
Hydin T A 8: 110,609,929 Y5113N possibly damaging Het
Iqsec3 C T 6: 121,413,471 probably benign Het
Kbtbd8 C A 6: 95,126,589 Y406* probably null Het
Lamb1 G T 12: 31,298,883 R590L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lnpk T C 2: 74,537,501 E165G probably damaging Het
Lrp4 C T 2: 91,475,212 R276C probably damaging Het
Lrrc7 T A 3: 158,135,391 T1384S probably benign Het
Mia2 T C 12: 59,170,994 probably null Het
Morc2a T C 11: 3,685,400 V797A probably damaging Het
Mrps23 T C 11: 88,205,367 probably benign Het
Muc3 A T 5: 137,146,636 I62K probably damaging Het
Nlrp4g T A 9: 124,349,630 noncoding transcript Het
Nptx1 A T 11: 119,544,843 probably benign Het
Olfr352 T A 2: 36,870,196 I210K possibly damaging Het
Pabpc1l T G 2: 164,044,382 probably null Het
Pdcd6ip A T 9: 113,674,507 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plcxd1 A G 5: 110,102,483 Q230R probably benign Het
Psme4 T A 11: 30,874,282 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptch1 T A 13: 63,542,224 N320Y probably damaging Het
Qars G A 9: 108,508,443 V60I possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rhag T C 17: 40,836,476 S410P probably damaging Het
Rnf213 A G 11: 119,410,144 K297E probably benign Het
Rps6ka4 T C 19: 6,837,352 E294G probably benign Het
Scaf4 T A 16: 90,244,356 I695F unknown Het
Scrn2 T C 11: 97,032,296 probably benign Het
Scx T A 15: 76,458,163 C188S probably damaging Het
Sdk1 G T 5: 142,212,050 V1893L possibly damaging Het
Sema5a C A 15: 32,673,400 Q795K probably damaging Het
Slc24a3 A G 2: 145,613,567 S459G probably benign Het
Smurf1 A G 5: 144,883,562 probably benign Het
Taar4 T C 10: 23,961,430 Y313H probably damaging Het
Tmprss11c A G 5: 86,271,463 F79S probably damaging Het
Tnfaip8l2 T A 3: 95,140,361 I64F possibly damaging Het
Trbv13-1 A G 6: 41,116,438 T102A probably damaging Het
Trpa1 A T 1: 14,905,998 N160K probably damaging Het
Ttc22 A G 4: 106,639,238 Y495C probably benign Het
Usp50 A G 2: 126,778,029 I121T probably damaging Het
Vmn2r117 A G 17: 23,459,911 S780P probably damaging Het
Wapl G A 14: 34,691,777 A199T probably benign Het
Zfp658 A G 7: 43,573,545 T415A possibly damaging Het
Zfp760 C T 17: 21,720,954 T9I probably damaging Het
Other mutations in Vmn2r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Vmn2r66 APN 7 85007091 missense probably benign
IGL01562:Vmn2r66 APN 7 85007287 missense probably benign 0.03
IGL01689:Vmn2r66 APN 7 85007825 missense probably damaging 1.00
IGL02237:Vmn2r66 APN 7 84994700 missense probably benign
IGL02415:Vmn2r66 APN 7 85006812 missense probably damaging 0.97
IGL02439:Vmn2r66 APN 7 85005247 splice site probably benign
IGL02545:Vmn2r66 APN 7 85006590 missense possibly damaging 0.50
IGL02708:Vmn2r66 APN 7 85006588 missense probably benign 0.00
IGL02794:Vmn2r66 APN 7 84995415 missense probably benign 0.00
IGL02885:Vmn2r66 APN 7 84995515 missense probably benign 0.00
IGL02975:Vmn2r66 APN 7 85006974 missense probably damaging 0.98
IGL03027:Vmn2r66 APN 7 84995569 splice site probably benign
IGL03081:Vmn2r66 APN 7 85007930 missense probably benign
PIT4131001:Vmn2r66 UTSW 7 84995093 missense probably damaging 1.00
R0098:Vmn2r66 UTSW 7 85005757 missense probably damaging 1.00
R0504:Vmn2r66 UTSW 7 85006815 missense probably damaging 0.99
R0557:Vmn2r66 UTSW 7 84994764 missense probably damaging 1.00
R0617:Vmn2r66 UTSW 7 84995276 missense probably benign 0.02
R0883:Vmn2r66 UTSW 7 85007862 missense probably benign
R1159:Vmn2r66 UTSW 7 84995405 missense probably benign 0.44
R1168:Vmn2r66 UTSW 7 85006854 missense possibly damaging 0.46
R1172:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1175:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1538:Vmn2r66 UTSW 7 84994958 missense possibly damaging 0.84
R1658:Vmn2r66 UTSW 7 85007747 missense probably benign 0.07
R1937:Vmn2r66 UTSW 7 84995136 missense probably damaging 0.99
R1989:Vmn2r66 UTSW 7 85011993 missense probably benign 0.01
R2890:Vmn2r66 UTSW 7 85011819 splice site probably null
R3686:Vmn2r66 UTSW 7 84995189 missense probably damaging 0.96
R4152:Vmn2r66 UTSW 7 85005592 missense probably benign 0.08
R4500:Vmn2r66 UTSW 7 85007954 missense probably damaging 1.00
R4618:Vmn2r66 UTSW 7 84995088 missense possibly damaging 0.62
R4656:Vmn2r66 UTSW 7 85011996 missense possibly damaging 0.87
R4668:Vmn2r66 UTSW 7 84994697 missense probably damaging 1.00
R4942:Vmn2r66 UTSW 7 85007772 missense probably damaging 1.00
R5163:Vmn2r66 UTSW 7 85006809 missense probably benign 0.01
R5223:Vmn2r66 UTSW 7 85007885 missense probably benign
R5377:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R5512:Vmn2r66 UTSW 7 85007941 missense probably damaging 1.00
R5611:Vmn2r66 UTSW 7 85005743 nonsense probably null
R5749:Vmn2r66 UTSW 7 85006771 nonsense probably null
R6131:Vmn2r66 UTSW 7 84995016 missense probably damaging 1.00
R6183:Vmn2r66 UTSW 7 84995558 missense possibly damaging 0.81
R6509:Vmn2r66 UTSW 7 85006846 missense probably benign 0.12
R6930:Vmn2r66 UTSW 7 85012008 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCTTGAATGCCAATACTACAG -3'
(R):5'- TCTGTACTAGACATGGATCAGTGTG -3'

Sequencing Primer
(F):5'- TTGTCTTAGCCAAGATAGTAGAGGC -3'
(R):5'- ACATGGATCAGTGTGTGAAGTGTCC -3'
Posted On2014-12-04