Incidental Mutation 'R2507:Trim6'
ID251328
Institutional Source Beutler Lab
Gene Symbol Trim6
Ensembl Gene ENSMUSG00000072244
Gene Nametripartite motif-containing 6
SynonymsC430046K18Rik, D7Ertd684e
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104218793-104235152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104228185 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 161 (F161L)
Ref Sequence ENSEMBL: ENSMUSP00000149805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098180] [ENSMUST00000128493] [ENSMUST00000144455] [ENSMUST00000153324] [ENSMUST00000214578]
Predicted Effect probably damaging
Transcript: ENSMUST00000097023
AA Change: F161L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094787
Gene: ENSMUSG00000072244
AA Change: F161L

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
PDB:2YRG|A 83 105 2e-8 PDB
coiled coil region 107 194 N/A INTRINSIC
PRY 274 325 5.31e-9 SMART
Pfam:SPRY 328 456 2.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098180
AA Change: F187L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095782
Gene: ENSMUSG00000072244
AA Change: F187L

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
BBOX 92 133 8.87e-11 SMART
low complexity region 194 211 N/A INTRINSIC
PRY 300 351 5.31e-9 SMART
Pfam:SPRY 354 482 9.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128493
SMART Domains Protein: ENSMUSP00000118859
Gene: ENSMUSG00000072244

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
Pfam:zf-B_box 93 125 1.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144455
SMART Domains Protein: ENSMUSP00000116233
Gene: ENSMUSG00000072244

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
Blast:BBOX 92 113 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144538
Predicted Effect probably benign
Transcript: ENSMUST00000153324
SMART Domains Protein: ENSMUSP00000119932
Gene: ENSMUSG00000072244

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
BBOX 92 133 8.87e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214578
AA Change: F161L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. The protein localizes to the nucleus, but its specific function has not been identified. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from this gene into the downstream TRIM34 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Trim6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Trim6 APN 7 104230743 missense probably benign 0.00
IGL02493:Trim6 APN 7 104232640 missense probably benign 0.04
IGL02517:Trim6 APN 7 104232357 splice site probably benign
R0026:Trim6 UTSW 7 104225809 synonymous probably null
R1505:Trim6 UTSW 7 104232564 missense probably damaging 1.00
R1711:Trim6 UTSW 7 104232837 missense probably damaging 1.00
R3919:Trim6 UTSW 7 104232850 missense probably damaging 1.00
R4731:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4732:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4733:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4858:Trim6 UTSW 7 104232485 nonsense probably null
R5120:Trim6 UTSW 7 104228240 missense probably damaging 1.00
R7147:Trim6 UTSW 7 104225570 missense probably benign 0.00
R7372:Trim6 UTSW 7 104232636 missense probably benign 0.04
R7407:Trim6 UTSW 7 104225901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGGGCCTGAGAACAGTTC -3'
(R):5'- TGGCCTCCTCATAGCTCAATAC -3'

Sequencing Primer
(F):5'- TGAGAACAGTTCCCACAGGCTTG -3'
(R):5'- AATACCTGCAGCAGTTCTACGGTG -3'
Posted On2014-12-04