Incidental Mutation 'R2507:Zfp426'
ID251350
Institutional Source Beutler Lab
Gene Symbol Zfp426
Ensembl Gene ENSMUSG00000059475
Gene Namezinc finger protein 426
SynonymsZfo61, Zfp68-rs1, 2900057C04Rik, KRAB1
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20468549-20492746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20470431 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 420 (K420R)
Ref Sequence ENSEMBL: ENSMUSP00000127045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080386] [ENSMUST00000115562] [ENSMUST00000163348] [ENSMUST00000163427] [ENSMUST00000164799] [ENSMUST00000164825] [ENSMUST00000166005] [ENSMUST00000167457] [ENSMUST00000168095] [ENSMUST00000169269] [ENSMUST00000169558]
Predicted Effect probably benign
Transcript: ENSMUST00000080386
AA Change: K406R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079250
Gene: ENSMUSG00000059475
AA Change: K406R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115562
AA Change: K406R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111224
Gene: ENSMUSG00000059475
AA Change: K406R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163348
AA Change: K405R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126446
Gene: ENSMUSG00000059475
AA Change: K405R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 218 240 2.12e-4 SMART
ZnF_C2H2 273 295 1.69e-3 SMART
ZnF_C2H2 301 323 8.81e-2 SMART
ZnF_C2H2 329 351 5.59e-4 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 1.43e-1 SMART
ZnF_C2H2 413 435 1.79e-2 SMART
ZnF_C2H2 441 463 1.22e-4 SMART
ZnF_C2H2 469 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.58e-2 SMART
ZnF_C2H2 527 549 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163427
Predicted Effect probably benign
Transcript: ENSMUST00000164799
SMART Domains Protein: ENSMUSP00000130120
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 53 93 1.2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164825
SMART Domains Protein: ENSMUSP00000127914
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166005
AA Change: K406R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129727
Gene: ENSMUSG00000059475
AA Change: K406R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166465
Predicted Effect probably benign
Transcript: ENSMUST00000167457
AA Change: K339R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130945
Gene: ENSMUSG00000059475
AA Change: K339R

DomainStartEndE-ValueType
KRAB 1 32 1.46e0 SMART
ZnF_C2H2 152 174 2.12e-4 SMART
ZnF_C2H2 207 229 1.69e-3 SMART
ZnF_C2H2 235 257 8.81e-2 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 3.16e-3 SMART
ZnF_C2H2 319 341 1.43e-1 SMART
ZnF_C2H2 347 369 1.79e-2 SMART
ZnF_C2H2 375 397 1.22e-4 SMART
ZnF_C2H2 403 425 1.38e-3 SMART
ZnF_C2H2 431 453 3.58e-2 SMART
ZnF_C2H2 461 483 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168095
SMART Domains Protein: ENSMUSP00000130309
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 83 1.37e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169269
SMART Domains Protein: ENSMUSP00000128843
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 69 7.16e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169558
AA Change: K420R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127045
Gene: ENSMUSG00000059475
AA Change: K420R

DomainStartEndE-ValueType
KRAB 53 113 5.56e-31 SMART
ZnF_C2H2 233 255 2.12e-4 SMART
ZnF_C2H2 288 310 1.69e-3 SMART
ZnF_C2H2 316 338 8.81e-2 SMART
ZnF_C2H2 344 366 5.59e-4 SMART
ZnF_C2H2 372 394 3.16e-3 SMART
ZnF_C2H2 400 422 1.43e-1 SMART
ZnF_C2H2 428 450 1.79e-2 SMART
ZnF_C2H2 456 478 1.22e-4 SMART
ZnF_C2H2 484 506 1.38e-3 SMART
ZnF_C2H2 512 534 3.58e-2 SMART
ZnF_C2H2 542 564 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kaposi's sarcoma-associated herpesvirus (KSHV) can be reactivated from latency by the viral protein RTA. The protein encoded by this gene is a zinc finger transcriptional repressor that interacts with RTA to modulate RTA-mediated reactivation of KSHV. While the encoded protein can repress KSHV reactivation, RTA can induce degradation of this protein through the ubiquitin-proteasome pathway to overcome the repression. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Other mutations in Zfp426
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Zfp426 APN 9 20478157 start codon destroyed possibly damaging 0.93
IGL02499:Zfp426 APN 9 20473118 splice site probably benign
R0157:Zfp426 UTSW 9 20471136 missense probably benign 0.00
R0356:Zfp426 UTSW 9 20471245 missense probably benign 0.15
R0456:Zfp426 UTSW 9 20470297 missense probably damaging 1.00
R0504:Zfp426 UTSW 9 20470031 missense probably damaging 0.96
R2352:Zfp426 UTSW 9 20470105 missense probably benign 0.08
R2509:Zfp426 UTSW 9 20470681 missense possibly damaging 0.68
R3771:Zfp426 UTSW 9 20473117 splice site probably null
R3772:Zfp426 UTSW 9 20473117 splice site probably null
R3773:Zfp426 UTSW 9 20473117 splice site probably null
R3864:Zfp426 UTSW 9 20470086 missense possibly damaging 0.88
R4649:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R4798:Zfp426 UTSW 9 20471014 missense probably benign 0.17
R4863:Zfp426 UTSW 9 20470038 missense probably damaging 1.00
R4894:Zfp426 UTSW 9 20475073 intron probably benign
R5421:Zfp426 UTSW 9 20470719 missense probably damaging 0.99
R6084:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R6610:Zfp426 UTSW 9 20473093 missense probably damaging 1.00
R7239:Zfp426 UTSW 9 20470591 missense probably benign 0.00
R7441:Zfp426 UTSW 9 20470851 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGCACAAACAAGGGCTTCC -3'
(R):5'- AGGTCTCACACTGGAGACAA -3'

Sequencing Primer
(F):5'- AGGATGACTGTAGGCTTTTCCACAC -3'
(R):5'- CACTGGAGACAAGCCCTATGG -3'
Posted On2014-12-04