Incidental Mutation 'R2698:Mia2'
ID251365
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission 040436-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R2698 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 59170994 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176727] [ENSMUST00000176752] [ENSMUST00000176892] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000219140]
Predicted Effect probably null
Transcript: ENSMUST00000069430
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170992
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175659
Predicted Effect probably benign
Transcript: ENSMUST00000175837
SMART Domains Protein: ENSMUSP00000134828
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 90 5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175877
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175912
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176223
Predicted Effect probably null
Transcript: ENSMUST00000176322
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176336
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176464
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176617
Predicted Effect probably benign
Transcript: ENSMUST00000176727
SMART Domains Protein: ENSMUSP00000135694
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176892
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177162
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177222
Predicted Effect probably null
Transcript: ENSMUST00000177225
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219140
Meta Mutation Damage Score 0.522 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,434 S59P probably damaging Het
Abcc9 T C 6: 142,633,136 R901G possibly damaging Het
Abhd18 T A 3: 40,930,966 M262K probably benign Het
Ano2 C A 6: 125,712,346 L145I probably benign Het
Ckap5 T C 2: 91,578,081 W874R probably damaging Het
Cox4i1 G T 8: 120,669,363 probably benign Het
Cwc27 A T 13: 104,806,751 N94K probably damaging Het
Dcaf11 T C 14: 55,566,885 S372P probably damaging Het
Dpysl4 A G 7: 139,096,765 N356S probably damaging Het
Dusp8 A G 7: 142,081,964 probably benign Het
Erc2 G A 14: 28,271,705 V894M probably benign Het
Fbxo28 T A 1: 182,317,154 I282F probably benign Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gabra4 T C 5: 71,572,078 H453R probably benign Het
Glrx T A 13: 75,839,946 probably null Het
Gm11541 A T 11: 94,695,615 L102* probably null Het
Gm5113 T A 7: 30,178,725 Y79* probably null Het
Gpr87 T A 3: 59,179,166 N306I probably damaging Het
Hydin T A 8: 110,609,929 Y5113N possibly damaging Het
Iqsec3 C T 6: 121,413,471 probably benign Het
Kbtbd8 C A 6: 95,126,589 Y406* probably null Het
Lamb1 G T 12: 31,298,883 R590L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lnpk T C 2: 74,537,501 E165G probably damaging Het
Lrp4 C T 2: 91,475,212 R276C probably damaging Het
Lrrc7 T A 3: 158,135,391 T1384S probably benign Het
Morc2a T C 11: 3,685,400 V797A probably damaging Het
Mrps23 T C 11: 88,205,367 probably benign Het
Muc3 A T 5: 137,146,636 I62K probably damaging Het
Nlrp4g T A 9: 124,349,630 noncoding transcript Het
Nptx1 A T 11: 119,544,843 probably benign Het
Olfr352 T A 2: 36,870,196 I210K possibly damaging Het
Pabpc1l T G 2: 164,044,382 probably null Het
Pdcd6ip A T 9: 113,674,507 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plcxd1 A G 5: 110,102,483 Q230R probably benign Het
Psme4 T A 11: 30,874,282 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptch1 T A 13: 63,542,224 N320Y probably damaging Het
Qars G A 9: 108,508,443 V60I possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rhag T C 17: 40,836,476 S410P probably damaging Het
Rnf213 A G 11: 119,410,144 K297E probably benign Het
Rps6ka4 T C 19: 6,837,352 E294G probably benign Het
Scaf4 T A 16: 90,244,356 I695F unknown Het
Scrn2 T C 11: 97,032,296 probably benign Het
Scx T A 15: 76,458,163 C188S probably damaging Het
Sdk1 G T 5: 142,212,050 V1893L possibly damaging Het
Sema5a C A 15: 32,673,400 Q795K probably damaging Het
Slc24a3 A G 2: 145,613,567 S459G probably benign Het
Smurf1 A G 5: 144,883,562 probably benign Het
Taar4 T C 10: 23,961,430 Y313H probably damaging Het
Tmprss11c A G 5: 86,271,463 F79S probably damaging Het
Tnfaip8l2 T A 3: 95,140,361 I64F possibly damaging Het
Trbv13-1 A G 6: 41,116,438 T102A probably damaging Het
Trpa1 A T 1: 14,905,998 N160K probably damaging Het
Ttc22 A G 4: 106,639,238 Y495C probably benign Het
Usp50 A G 2: 126,778,029 I121T probably damaging Het
Vmn2r117 A G 17: 23,459,911 S780P probably damaging Het
Vmn2r66 A T 7: 84,995,399 V601D probably damaging Het
Wapl G A 14: 34,691,777 A199T probably benign Het
Zfp658 A G 7: 43,573,545 T415A possibly damaging Het
Zfp760 C T 17: 21,720,954 T9I probably damaging Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7291:Mia2 UTSW 12 59158369 critical splice donor site probably null
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTACCTTTGCATGGTAAGCC -3'
(R):5'- TTCTCAGTGCATCCTGTGG -3'

Sequencing Primer
(F):5'- CGGCTAACTTGTTTAAGAGTTCC -3'
(R):5'- AGTGCATCCTGTGGTCTCTAATAC -3'
Posted On2014-12-04