Incidental Mutation 'R2698:Vmn2r117'
ID251395
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Namevomeronasal 2, receptor 117
SynonymsEG619788
MMRRC Submission 040436-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R2698 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23459675-23479597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23459911 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 780 (S780P)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
Predicted Effect probably damaging
Transcript: ENSMUST00000171996
AA Change: S780P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: S780P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,434 S59P probably damaging Het
Abcc9 T C 6: 142,633,136 R901G possibly damaging Het
Abhd18 T A 3: 40,930,966 M262K probably benign Het
Ano2 C A 6: 125,712,346 L145I probably benign Het
Ckap5 T C 2: 91,578,081 W874R probably damaging Het
Cox4i1 G T 8: 120,669,363 probably benign Het
Cwc27 A T 13: 104,806,751 N94K probably damaging Het
Dcaf11 T C 14: 55,566,885 S372P probably damaging Het
Dpysl4 A G 7: 139,096,765 N356S probably damaging Het
Dusp8 A G 7: 142,081,964 probably benign Het
Erc2 G A 14: 28,271,705 V894M probably benign Het
Fbxo28 T A 1: 182,317,154 I282F probably benign Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gabra4 T C 5: 71,572,078 H453R probably benign Het
Glrx T A 13: 75,839,946 probably null Het
Gm11541 A T 11: 94,695,615 L102* probably null Het
Gm5113 T A 7: 30,178,725 Y79* probably null Het
Gpr87 T A 3: 59,179,166 N306I probably damaging Het
Hydin T A 8: 110,609,929 Y5113N possibly damaging Het
Iqsec3 C T 6: 121,413,471 probably benign Het
Kbtbd8 C A 6: 95,126,589 Y406* probably null Het
Lamb1 G T 12: 31,298,883 R590L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lnpk T C 2: 74,537,501 E165G probably damaging Het
Lrp4 C T 2: 91,475,212 R276C probably damaging Het
Lrrc7 T A 3: 158,135,391 T1384S probably benign Het
Mia2 T C 12: 59,170,994 probably null Het
Morc2a T C 11: 3,685,400 V797A probably damaging Het
Mrps23 T C 11: 88,205,367 probably benign Het
Muc3 A T 5: 137,146,636 I62K probably damaging Het
Nlrp4g T A 9: 124,349,630 noncoding transcript Het
Nptx1 A T 11: 119,544,843 probably benign Het
Olfr352 T A 2: 36,870,196 I210K possibly damaging Het
Pabpc1l T G 2: 164,044,382 probably null Het
Pdcd6ip A T 9: 113,674,507 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plcxd1 A G 5: 110,102,483 Q230R probably benign Het
Psme4 T A 11: 30,874,282 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptch1 T A 13: 63,542,224 N320Y probably damaging Het
Qars G A 9: 108,508,443 V60I possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rhag T C 17: 40,836,476 S410P probably damaging Het
Rnf213 A G 11: 119,410,144 K297E probably benign Het
Rps6ka4 T C 19: 6,837,352 E294G probably benign Het
Scaf4 T A 16: 90,244,356 I695F unknown Het
Scrn2 T C 11: 97,032,296 probably benign Het
Scx T A 15: 76,458,163 C188S probably damaging Het
Sdk1 G T 5: 142,212,050 V1893L possibly damaging Het
Sema5a C A 15: 32,673,400 Q795K probably damaging Het
Slc24a3 A G 2: 145,613,567 S459G probably benign Het
Smurf1 A G 5: 144,883,562 probably benign Het
Taar4 T C 10: 23,961,430 Y313H probably damaging Het
Tmprss11c A G 5: 86,271,463 F79S probably damaging Het
Tnfaip8l2 T A 3: 95,140,361 I64F possibly damaging Het
Trbv13-1 A G 6: 41,116,438 T102A probably damaging Het
Trpa1 A T 1: 14,905,998 N160K probably damaging Het
Ttc22 A G 4: 106,639,238 Y495C probably benign Het
Usp50 A G 2: 126,778,029 I121T probably damaging Het
Vmn2r66 A T 7: 84,995,399 V601D probably damaging Het
Wapl G A 14: 34,691,777 A199T probably benign Het
Zfp658 A G 7: 43,573,545 T415A possibly damaging Het
Zfp760 C T 17: 21,720,954 T9I probably damaging Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23477840 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23475429 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23479546 missense probably benign
IGL01078:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23478382 missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23477241 missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23475382 missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23477225 missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23459784 missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23475578 splice site probably benign
IGL03167:Vmn2r117 APN 17 23477707 missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23460165 missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23475514 missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23475503 nonsense probably null
R1411:Vmn2r117 UTSW 17 23460553 missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23478473 missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23477455 missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23478389 missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23477480 missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23477644 missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23460256 missense possibly damaging 0.55
R2972:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23460106 missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23479513 frame shift probably null
R4560:Vmn2r117 UTSW 17 23459877 missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23478416 missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23477885 missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23459838 missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23479513 frame shift probably null
R5078:Vmn2r117 UTSW 17 23460148 missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23477874 nonsense probably null
R5774:Vmn2r117 UTSW 17 23477202 missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23479561 missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23460114 missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23460219 missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23460049 nonsense probably null
R6736:Vmn2r117 UTSW 17 23478308 missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23479563 missense probably damaging 0.99
V5622:Vmn2r117 UTSW 17 23477840 missense probably damaging 1.00
V5622:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCATTGGAAGATGATTTCACCCTG -3'
(R):5'- AGTCTGGCTGAGAGCTTCTC -3'

Sequencing Primer
(F):5'- GATTTCACCCTGATCATTTCAAGAG -3'
(R):5'- CCTCCTTCTGTTGATATTGATGCAC -3'
Posted On2014-12-04