Incidental Mutation 'R0310:Tmtc1'
ID25142
Institutional Source Beutler Lab
Gene Symbol Tmtc1
Ensembl Gene ENSMUSG00000030306
Gene Nametransmembrane and tetratricopeptide repeat containing 1
Synonyms
MMRRC Submission 038520-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R0310 (G1)
Quality Score213
Status Validated
Chromosome6
Chromosomal Location148232430-148444389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148249581 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 659 (K659E)
Ref Sequence ENSEMBL: ENSMUSP00000056353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060095] [ENSMUST00000100772] [ENSMUST00000140797]
Predicted Effect probably benign
Transcript: ENSMUST00000060095
AA Change: K659E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000056353
Gene: ENSMUSG00000030306
AA Change: K659E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
Pfam:DUF1736 351 425 1.3e-33 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 543 576 2.42e-3 SMART
TPR 577 607 8.76e-1 SMART
TPR 608 641 1.69e-2 SMART
TPR 642 675 1.28e-2 SMART
TPR 676 709 4.31e0 SMART
TPR 710 743 1.11e-2 SMART
TPR 744 776 4.62e0 SMART
TPR 811 844 1.1e-1 SMART
TPR 849 882 4.45e-2 SMART
TPR 883 916 1.05e-3 SMART
low complexity region 926 941 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100772
AA Change: K621E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098335
Gene: ENSMUSG00000030306
AA Change: K621E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
Pfam:DUF1736 349 427 6.9e-35 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 539 569 8.76e-1 SMART
TPR 570 603 1.69e-2 SMART
TPR 604 637 1.28e-2 SMART
TPR 638 671 4.31e0 SMART
TPR 672 705 1.11e-2 SMART
TPR 706 738 4.62e0 SMART
TPR 773 806 1.1e-1 SMART
TPR 811 844 4.45e-2 SMART
TPR 845 878 1.05e-3 SMART
low complexity region 888 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140797
SMART Domains Protein: ENSMUSP00000115543
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Pfam:DUF1736 259 337 9.9e-36 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 403 425 N/A INTRINSIC
Pfam:TPR_12 449 516 9.6e-10 PFAM
Pfam:TPR_11 451 498 1.3e-9 PFAM
Pfam:TPR_1 453 486 5.7e-6 PFAM
Pfam:TPR_2 453 486 2.6e-7 PFAM
Pfam:TPR_8 453 486 6.5e-4 PFAM
Pfam:TPR_1 487 517 1.6e-3 PFAM
Pfam:TPR_8 496 518 1.5e-3 PFAM
low complexity region 521 539 N/A INTRINSIC
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.3%
  • 20x: 82.5%
Validation Efficiency 99% (113/114)
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,425,671 T92P probably damaging Het
9530053A07Rik G T 7: 28,142,274 V545L probably benign Het
Abca13 T C 11: 9,293,810 V1891A probably benign Het
Abcc1 T A 16: 14,410,927 I346N probably damaging Het
Afdn G T 17: 13,885,508 probably null Het
Ahrr G A 13: 74,283,024 probably benign Het
Akap13 A G 7: 75,614,930 D507G probably damaging Het
Akap8 A T 17: 32,316,260 M260K possibly damaging Het
Akr1b8 T C 6: 34,365,259 V265A probably benign Het
Alpk3 C G 7: 81,078,610 P496R possibly damaging Het
Ankrd13b A G 11: 77,472,745 V249A possibly damaging Het
Arid4a T C 12: 71,075,830 V995A probably benign Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atad2 G A 15: 58,114,257 A499V probably damaging Het
Barhl2 G T 5: 106,457,387 A152E possibly damaging Het
Bbs12 T A 3: 37,321,045 D547E probably damaging Het
Btaf1 A G 19: 37,004,534 M1655V probably damaging Het
Ccdc50 T A 16: 27,406,658 H40Q probably damaging Het
Ccr9 A T 9: 123,774,552 probably benign Het
Cdh15 A G 8: 122,865,436 D654G probably damaging Het
Cebpz T C 17: 78,926,124 D758G probably damaging Het
Cgn C T 3: 94,765,653 R906K possibly damaging Het
Chil3 T A 3: 106,160,523 M109L possibly damaging Het
Cntnap4 A T 8: 112,842,516 probably null Het
Cyp4f18 C T 8: 72,001,012 probably benign Het
Daam2 A G 17: 49,463,924 probably null Het
Ddost T A 4: 138,310,611 H220Q probably benign Het
Dennd2a C T 6: 39,464,201 probably benign Het
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dnah5 A T 15: 28,299,110 R1539S probably benign Het
Dusp22 T C 13: 30,705,658 I74T probably damaging Het
Dyx1c1 A T 9: 72,972,336 D386V probably damaging Het
E130309D02Rik G T 5: 143,307,888 T278K probably benign Het
Epc1 A G 18: 6,440,202 probably benign Het
Epha7 A G 4: 28,961,301 I845V probably benign Het
Fanci C T 7: 79,407,417 probably benign Het
Fbn1 T A 2: 125,363,644 E1104V probably damaging Het
Fbxo8 T A 8: 56,590,097 F205L probably damaging Het
Fetub T C 16: 22,929,756 probably benign Het
Frs3 T C 17: 47,703,822 V480A probably benign Het
Gne C A 4: 44,060,157 E79* probably null Het
Hrc T A 7: 45,336,497 H357Q probably benign Het
Idh1 T C 1: 65,161,920 M291V probably damaging Het
Iltifb T A 10: 118,293,185 H133L probably benign Het
Ino80b T C 6: 83,124,091 E165G probably damaging Het
Inppl1 A T 7: 101,828,499 probably benign Het
Ip6k2 T C 9: 108,799,233 probably benign Het
Itga11 A T 9: 62,760,346 I654F probably damaging Het
Jag2 G T 12: 112,913,377 probably benign Het
Katna1 G T 10: 7,743,749 probably benign Het
Kcnh4 G T 11: 100,746,169 S707Y probably benign Het
Kcnn2 T G 18: 45,560,518 L387R probably damaging Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Lama5 G T 2: 180,181,566 probably benign Het
Lmbr1l A T 15: 98,908,773 probably benign Het
Mast4 A T 13: 102,754,161 S870T possibly damaging Het
Med1 A G 11: 98,167,574 Y266H probably benign Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mgam T C 6: 40,761,035 probably benign Het
Mmp8 A G 9: 7,561,454 Q153R probably benign Het
Mpeg1 C A 19: 12,461,691 T171N probably benign Het
Mtus2 T C 5: 148,107,019 S806P probably benign Het
Naip2 T A 13: 100,148,842 E1226V probably damaging Het
Naip6 A G 13: 100,308,213 F246L possibly damaging Het
Nav3 T C 10: 109,767,128 I1187V possibly damaging Het
Nbeal1 T C 1: 60,305,370 probably benign Het
Nbeal2 C A 9: 110,638,163 V653L probably damaging Het
Ndufa9 G T 6: 126,827,532 probably benign Het
Nlrp5 G T 7: 23,430,157 C883F probably damaging Het
Nr0b2 C A 4: 133,555,992 probably null Het
Olfr24 T A 9: 18,755,333 M101L possibly damaging Het
Olfr799 T A 10: 129,647,731 V201E probably damaging Het
Olfr822 G A 10: 130,074,823 V138I probably benign Het
Olfr888 T A 9: 38,109,486 S267T possibly damaging Het
Pkhd1 A T 1: 20,549,822 probably null Het
Pkhd1l1 A G 15: 44,522,738 probably benign Het
Ppm1l A G 3: 69,549,461 K237R probably benign Het
Ppp1r18 T C 17: 35,873,711 probably benign Het
Ptpn3 A T 4: 57,204,958 D734E probably benign Het
Pxdn T C 12: 30,015,529 C1283R probably damaging Het
Rbm12 A G 2: 156,095,724 probably benign Het
Rttn A T 18: 89,009,460 probably benign Het
Sgsm1 G T 5: 113,263,705 H431Q probably benign Het
Siah3 A G 14: 75,525,927 N206S possibly damaging Het
Slc22a15 G T 3: 101,860,511 D521E probably benign Het
Sprr2k A T 3: 92,433,463 probably benign Het
Stab2 G A 10: 86,967,613 probably benign Het
Sval3 T A 6: 41,968,186 L16Q probably damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Tk1 T C 11: 117,817,095 probably benign Het
Tlk2 C A 11: 105,254,973 A335E probably benign Het
Tnk2 C T 16: 32,680,590 P907L probably benign Het
Trim14 C A 4: 46,522,043 K211N probably damaging Het
Trim15 A C 17: 36,866,986 L39R probably damaging Het
Tspan15 T A 10: 62,188,093 T269S probably benign Het
Ttc7 T A 17: 87,361,864 D646E probably benign Het
Ttll6 A T 11: 96,147,556 Q410L probably benign Het
Unc79 A G 12: 103,061,407 Q419R probably damaging Het
Vcam1 A T 3: 116,114,416 Y666N possibly damaging Het
Vmn1r10 A T 6: 57,113,501 Y26F probably damaging Het
Vmn1r80 A G 7: 12,193,848 N295S probably benign Het
Vmn2r114 A T 17: 23,290,943 H854Q probably benign Het
Vmn2r2 A T 3: 64,134,618 D225E probably damaging Het
Vmn2r4 A T 3: 64,389,434 Y643* probably null Het
Vmn2r52 T A 7: 10,159,466 Y582F probably damaging Het
Vmn2r60 G T 7: 42,195,140 L642F possibly damaging Het
Zbtb20 T C 16: 43,609,746 S207P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zkscan7 G T 9: 122,888,893 E118* probably null Het
Other mutations in Tmtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmtc1 APN 6 148443944 missense probably benign 0.02
IGL01377:Tmtc1 APN 6 148245787 missense possibly damaging 0.82
IGL01728:Tmtc1 APN 6 148411066 missense probably benign 0.02
IGL02904:Tmtc1 APN 6 148249482 splice site probably benign
R0044:Tmtc1 UTSW 6 148412829 splice site probably benign
R0107:Tmtc1 UTSW 6 148425913 missense possibly damaging 0.85
R0114:Tmtc1 UTSW 6 148412830 splice site probably benign
R0243:Tmtc1 UTSW 6 148246837 missense probably damaging 1.00
R0441:Tmtc1 UTSW 6 148415758 missense probably damaging 1.00
R0491:Tmtc1 UTSW 6 148412640 critical splice donor site probably null
R0578:Tmtc1 UTSW 6 148355218 intron probably benign
R0685:Tmtc1 UTSW 6 148411240 missense probably benign 0.39
R1470:Tmtc1 UTSW 6 148305985 splice site probably benign
R1533:Tmtc1 UTSW 6 148245710 critical splice donor site probably null
R1577:Tmtc1 UTSW 6 148412820 critical splice acceptor site probably null
R1617:Tmtc1 UTSW 6 148355404 intron probably benign
R1763:Tmtc1 UTSW 6 148294618 missense probably damaging 1.00
R1909:Tmtc1 UTSW 6 148444048 missense possibly damaging 0.93
R1943:Tmtc1 UTSW 6 148425918 nonsense probably null
R2050:Tmtc1 UTSW 6 148262883 missense probably damaging 1.00
R2305:Tmtc1 UTSW 6 148244697 missense probably damaging 0.99
R3813:Tmtc1 UTSW 6 148354891 intron probably benign
R4355:Tmtc1 UTSW 6 148355098 intron probably benign
R4537:Tmtc1 UTSW 6 148262782 critical splice donor site probably null
R4731:Tmtc1 UTSW 6 148284980 splice site probably null
R4732:Tmtc1 UTSW 6 148284980 splice site probably null
R4733:Tmtc1 UTSW 6 148284980 splice site probably null
R4960:Tmtc1 UTSW 6 148443947 unclassified probably benign
R5048:Tmtc1 UTSW 6 148237846 missense possibly damaging 0.96
R5118:Tmtc1 UTSW 6 148269987 intron probably benign
R5279:Tmtc1 UTSW 6 148355131 intron probably benign
R5310:Tmtc1 UTSW 6 148355412 intron probably benign
R5411:Tmtc1 UTSW 6 148443899 critical splice donor site probably null
R5646:Tmtc1 UTSW 6 148246831 missense probably damaging 1.00
R5868:Tmtc1 UTSW 6 148237855 missense probably damaging 1.00
R6482:Tmtc1 UTSW 6 148412745 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACACAGTGTAGGGTGGTCAGAAG -3'
(R):5'- ACGTTTGCAGTGGTAGGAACTGAG -3'

Sequencing Primer
(F):5'- TCAGAAGTGTGGGCCACC -3'
(R):5'- ACACCTGTGCTTGTACACTATG -3'
Posted On2013-04-16