Incidental Mutation 'R2844:Tgfbr3l'
ID251432
Institutional Source Beutler Lab
Gene Symbol Tgfbr3l
Ensembl Gene ENSMUSG00000089736
Gene Nametransforming growth factor, beta receptor III-like
SynonymsLOC100039590, Gm14378
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2844 (G1)
Quality Score148
Status Validated
Chromosome8
Chromosomal Location4248214-4251423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4249280 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 49 (D49G)
Ref Sequence ENSEMBL: ENSMUSP00000106621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000011981] [ENSMUST00000062686] [ENSMUST00000110993] [ENSMUST00000110994] [ENSMUST00000110995] [ENSMUST00000110996] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000129866] [ENSMUST00000145165] [ENSMUST00000208316] [ENSMUST00000208459]
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011981
SMART Domains Protein: ENSMUSP00000011981
Gene: ENSMUSG00000011837

DomainStartEndE-ValueType
Pfam:SnAPC_2_like 1 356 5.9e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110993
AA Change: D49G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106621
Gene: ENSMUSG00000089736
AA Change: D49G

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:Zona_pellucida 16 161 6.6e-15 PFAM
low complexity region 210 224 N/A INTRINSIC
low complexity region 227 263 N/A INTRINSIC
low complexity region 269 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110994
SMART Domains Protein: ENSMUSP00000106622
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110995
SMART Domains Protein: ENSMUSP00000106623
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
low complexity region 346 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110996
SMART Domains Protein: ENSMUSP00000106624
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
S_TKc 92 352 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129537
Predicted Effect probably benign
Transcript: ENSMUST00000129866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142865
Predicted Effect silent
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208029
Predicted Effect probably benign
Transcript: ENSMUST00000208316
Predicted Effect probably benign
Transcript: ENSMUST00000208459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209051
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Tgfbr3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0526:Tgfbr3l UTSW 8 4249439 missense possibly damaging 0.93
R1757:Tgfbr3l UTSW 8 4249548 missense probably benign 0.43
R1764:Tgfbr3l UTSW 8 4249282 missense probably benign 0.02
R1899:Tgfbr3l UTSW 8 4249600 missense probably damaging 1.00
R2266:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2267:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2268:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2845:Tgfbr3l UTSW 8 4249280 missense probably damaging 0.97
R2846:Tgfbr3l UTSW 8 4249280 missense probably damaging 0.97
R4695:Tgfbr3l UTSW 8 4250574 missense probably benign 0.33
R5059:Tgfbr3l UTSW 8 4249343 critical splice donor site probably null
R5708:Tgfbr3l UTSW 8 4250360 missense probably damaging 0.96
R5749:Tgfbr3l UTSW 8 4249310 missense probably damaging 0.97
R6898:Tgfbr3l UTSW 8 4250365 missense possibly damaging 0.70
R7078:Tgfbr3l UTSW 8 4249238 missense probably damaging 0.98
X0021:Tgfbr3l UTSW 8 4249642 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAATTTGGCATGCGGCTGAG -3'
(R):5'- AAGGTGTTACTGAGCATCGG -3'

Sequencing Primer
(F):5'- CTGAGCATGGGTAAAGAGACCACC -3'
(R):5'- TTACTGAGCATCGGTGAAGGGC -3'
Posted On2014-12-04