Incidental Mutation 'R2844:Afg3l1'
ID251434
Institutional Source Beutler Lab
Gene Symbol Afg3l1
Ensembl Gene ENSMUSG00000031967
Gene NameAFG3-like AAA ATPase 1
Synonyms3110061K15Rik, 1700047G05Rik
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R2844 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123477903-123503916 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 123494939 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001520] [ENSMUST00000098320] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000001520
SMART Domains Protein: ENSMUSP00000001520
Gene: ENSMUSG00000031967

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 1.2e-8 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Pfam:Peptidase_M41 533 736 6.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098320
SMART Domains Protein: ENSMUSP00000095924
Gene: ENSMUSG00000031967

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 6.5e-9 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152469
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no detectable myelination defects or axonal degeneration in the brain and spinal cord and normal mitochondria in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Afg3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Afg3l1 APN 8 123487389 missense probably benign 0.01
IGL01547:Afg3l1 APN 8 123501351 missense probably benign 0.17
IGL01612:Afg3l1 APN 8 123494853 missense probably benign 0.01
IGL01616:Afg3l1 APN 8 123502007 missense probably damaging 1.00
IGL01969:Afg3l1 APN 8 123480431 missense probably damaging 1.00
IGL01996:Afg3l1 APN 8 123501894 missense probably damaging 0.99
IGL02591:Afg3l1 APN 8 123486009 missense probably damaging 1.00
R0370:Afg3l1 UTSW 8 123501554 missense probably damaging 1.00
R1775:Afg3l1 UTSW 8 123492900 missense possibly damaging 0.89
R1817:Afg3l1 UTSW 8 123501931 missense probably damaging 0.99
R2152:Afg3l1 UTSW 8 123494836 missense probably damaging 1.00
R2516:Afg3l1 UTSW 8 123501954 missense probably damaging 0.99
R3013:Afg3l1 UTSW 8 123484677 missense probably benign 0.27
R3732:Afg3l1 UTSW 8 123501233 missense probably damaging 1.00
R4565:Afg3l1 UTSW 8 123501869 nonsense probably null
R4603:Afg3l1 UTSW 8 123501935 missense probably benign 0.43
R4888:Afg3l1 UTSW 8 123488326 critical splice donor site probably null
R4932:Afg3l1 UTSW 8 123501380 missense probably damaging 1.00
R4970:Afg3l1 UTSW 8 123498653 missense probably benign 0.04
R5027:Afg3l1 UTSW 8 123489814 missense probably benign 0.00
R5133:Afg3l1 UTSW 8 123489793 missense probably benign 0.16
R5457:Afg3l1 UTSW 8 123489968 missense possibly damaging 0.88
R5911:Afg3l1 UTSW 8 123500039 missense possibly damaging 0.79
R6268:Afg3l1 UTSW 8 123492926 missense probably damaging 1.00
R7116:Afg3l1 UTSW 8 123489862 missense probably damaging 0.98
R7303:Afg3l1 UTSW 8 123501269 missense probably damaging 1.00
Z1088:Afg3l1 UTSW 8 123488242 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCACATGTTGGAGGCAGGAG -3'
(R):5'- TAGAAATCCACAAACTCAGATGGG -3'

Sequencing Primer
(F):5'- TGAGTAGTTATGAGGAAACCCATCCC -3'
(R):5'- GGTACCAACTGGCATTAAACTAAG -3'
Posted On2014-12-04