Incidental Mutation 'R2844:Mark2'
ID251479
Institutional Source Beutler Lab
Gene Symbol Mark2
Ensembl Gene ENSMUSG00000024969
Gene NameMAP/microtubule affinity regulating kinase 2
SynonymsEmk, Par-1
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R2844 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7275396-7341860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7286862 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 116 (E116G)
Ref Sequence ENSEMBL: ENSMUSP00000129894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025921] [ENSMUST00000032557] [ENSMUST00000051711] [ENSMUST00000164129] [ENSMUST00000164205] [ENSMUST00000165286] [ENSMUST00000165965] [ENSMUST00000165989] [ENSMUST00000166461] [ENSMUST00000167767] [ENSMUST00000168324] [ENSMUST00000168872] [ENSMUST00000169541] [ENSMUST00000171352] [ENSMUST00000171393]
Predicted Effect probably damaging
Transcript: ENSMUST00000025921
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025921
Gene: ENSMUSG00000024969
AA Change: E116G

DomainStartEndE-ValueType
S_TKc 20 271 1.59e-108 SMART
UBA 292 329 7.69e-7 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
Pfam:KA1 697 743 2.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032557
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032557
Gene: ENSMUSG00000024969
AA Change: E149G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 685 731 5.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051711
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108969
Gene: ENSMUSG00000024969
AA Change: E149G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 730 776 6.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163345
SMART Domains Protein: ENSMUSP00000125944
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164129
Predicted Effect probably damaging
Transcript: ENSMUST00000164205
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127827
Gene: ENSMUSG00000024969
AA Change: E149G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 676 722 5.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165286
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126468
Gene: ENSMUSG00000024969
AA Change: E149G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 670 716 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165881
SMART Domains Protein: ENSMUSP00000126753
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165965
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131684
Gene: ENSMUSG00000024969
AA Change: E149G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165989
SMART Domains Protein: ENSMUSP00000129924
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 53 89 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166461
SMART Domains Protein: ENSMUSP00000128549
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Pfam:KA1 261 307 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167767
SMART Domains Protein: ENSMUSP00000132482
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
PDB:3OSE|A 220 264 1e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168852
Predicted Effect probably damaging
Transcript: ENSMUST00000168872
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128560
Gene: ENSMUSG00000024969
AA Change: E149G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 661 707 5.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169541
SMART Domains Protein: ENSMUSP00000128779
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 53 110 1.7e-12 PFAM
Pfam:Pkinase_Tyr 53 110 7.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170768
Predicted Effect probably benign
Transcript: ENSMUST00000171352
SMART Domains Protein: ENSMUSP00000129490
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171393
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129894
Gene: ENSMUSG00000024969
AA Change: E116G

DomainStartEndE-ValueType
Pfam:Pkinase 20 193 1.2e-59 PFAM
Pfam:Pkinase_Tyr 20 193 1.2e-35 PFAM
Pfam:RIO1 30 174 3e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171721
AA Change: E139G
SMART Domains Protein: ENSMUSP00000129506
Gene: ENSMUSG00000024969
AA Change: E139G

DomainStartEndE-ValueType
S_TKc 44 295 1.59e-108 SMART
UBA 316 353 7.69e-7 SMART
low complexity region 499 513 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit proportionate dwarfism with smaller pituitaries and reduced growth hormone and prolactin secretion. Mutants develop autoimmunity and fail to breed when mated to each other. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Mark2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Mark2 APN 19 7341184 missense possibly damaging 0.53
IGL01522:Mark2 APN 19 7281238 missense probably benign 0.06
IGL02368:Mark2 APN 19 7284490 missense probably damaging 1.00
IGL02836:Mark2 APN 19 7278040 critical splice donor site probably null
IGL03233:Mark2 APN 19 7284726 missense possibly damaging 0.89
R0015:Mark2 UTSW 19 7285777 nonsense probably null
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0335:Mark2 UTSW 19 7281828 missense probably benign 0.27
R0627:Mark2 UTSW 19 7281960 critical splice acceptor site probably null
R0734:Mark2 UTSW 19 7285981 splice site probably benign
R0744:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R0836:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R1099:Mark2 UTSW 19 7277425 missense probably benign 0.41
R1861:Mark2 UTSW 19 7290763 missense possibly damaging 0.73
R1873:Mark2 UTSW 19 7284515 missense probably damaging 1.00
R2160:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2161:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2162:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2308:Mark2 UTSW 19 7281934 missense probably damaging 1.00
R2845:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2846:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2902:Mark2 UTSW 19 7283448 missense probably benign 0.00
R2935:Mark2 UTSW 19 7285889 missense probably benign 0.09
R3853:Mark2 UTSW 19 7277290 missense probably damaging 1.00
R4377:Mark2 UTSW 19 7290689 missense possibly damaging 0.66
R4522:Mark2 UTSW 19 7285948 missense probably damaging 1.00
R4737:Mark2 UTSW 19 7281232 missense probably damaging 0.96
R5103:Mark2 UTSW 19 7284503 missense probably damaging 1.00
R5154:Mark2 UTSW 19 7283074 missense probably damaging 0.99
R5579:Mark2 UTSW 19 7282816 missense probably damaging 1.00
R6163:Mark2 UTSW 19 7290761 missense probably benign 0.00
R6186:Mark2 UTSW 19 7283202 missense probably benign 0.01
R6387:Mark2 UTSW 19 7285902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGCGTCTGAAAGTGAAAC -3'
(R):5'- GTGATCGAGACTGAGAAGACTC -3'

Sequencing Primer
(F):5'- CAGAACTGTTGCTGGTGACC -3'
(R):5'- GAGAAGACTCTCTACCTTGTCATGG -3'
Posted On2014-12-04